ID: 1113379039

View in Genome Browser
Species Human (GRCh38)
Location 13:109786420-109786442
Sequence CGGCGGCAGCAGCCCCGGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 256}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113379039_1113379045 -2 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379045 13:109786441-109786463 CGCGTCGCGCTCCGGGAAGCCGG 0: 1
1: 0
2: 0
3: 3
4: 44
1113379039_1113379054 19 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379054 13:109786462-109786484 GGGGTGCGCCCGGGCGCTCGGGG 0: 1
1: 0
2: 2
3: 15
4: 157
1113379039_1113379050 10 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379050 13:109786453-109786475 CGGGAAGCCGGGGTGCGCCCGGG 0: 1
1: 0
2: 2
3: 11
4: 167
1113379039_1113379042 -9 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379042 13:109786434-109786456 CTGCCGCCGCGTCGCGCTCCGGG 0: 1
1: 0
2: 0
3: 17
4: 153
1113379039_1113379053 18 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379053 13:109786461-109786483 CGGGGTGCGCCCGGGCGCTCGGG 0: 1
1: 0
2: 3
3: 16
4: 157
1113379039_1113379041 -10 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379041 13:109786433-109786455 GCTGCCGCCGCGTCGCGCTCCGG 0: 1
1: 0
2: 0
3: 16
4: 116
1113379039_1113379047 0 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379047 13:109786443-109786465 CGTCGCGCTCCGGGAAGCCGGGG 0: 1
1: 0
2: 1
3: 3
4: 101
1113379039_1113379046 -1 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379046 13:109786442-109786464 GCGTCGCGCTCCGGGAAGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 67
1113379039_1113379052 17 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379052 13:109786460-109786482 CCGGGGTGCGCCCGGGCGCTCGG 0: 1
1: 0
2: 0
3: 23
4: 168
1113379039_1113379049 9 Left 1113379039 13:109786420-109786442 CCGCACCGGGGCTGCTGCCGCCG 0: 1
1: 0
2: 0
3: 24
4: 256
Right 1113379049 13:109786452-109786474 CCGGGAAGCCGGGGTGCGCCCGG 0: 1
1: 0
2: 2
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113379039 Original CRISPR CGGCGGCAGCAGCCCCGGTG CGG (reversed) Exonic
900100251 1:959420-959442 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
900283871 1:1890377-1890399 CGGCGGCCGGAGCCCCCGCGCGG - Intronic
900722297 1:4185096-4185118 GGGTGGCAGCAGCCACTGTGCGG + Intergenic
901130036 1:6956607-6956629 CGGTGGCAGCAGTACCTGTGTGG + Intronic
901316757 1:8314985-8315007 CAGCGGCCGCAGCCCGGCTGGGG - Intergenic
901443432 1:9293050-9293072 CGGCGGCGGCACCCCGGGCGCGG + Exonic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902441604 1:16433645-16433667 CGGAGGCAGAAGCCCCAGAGGGG + Intronic
902585850 1:17438352-17438374 CGGCGGCAGCAGCGGCGACGAGG - Exonic
902786817 1:18738323-18738345 CGGCAGCGGCAGCCCCGGCCTGG + Intronic
902911042 1:19597301-19597323 CCGGAGCAGCAGCCCGGGTGCGG + Intronic
903573371 1:24322315-24322337 CGGCGGCGGCGGCCGCGGTCAGG - Intronic
904620456 1:31772038-31772060 CGGCGGCGGCGGCGCGGGTGTGG + Intergenic
905309174 1:37037627-37037649 CGCAGGCAGCAGCCCCAGTGGGG - Intergenic
905806979 1:40884372-40884394 CGGCGGCGGCAGCCGCGTCGGGG - Intergenic
906804702 1:48769404-48769426 TGTTGGCAGCAGCCCTGGTGAGG - Intronic
910787998 1:91021661-91021683 CGGCGGCCGCCGCCGCGGGGCGG - Intronic
912383284 1:109259016-109259038 CGGCTGCGGCAGCGCCCGTGGGG - Exonic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912706770 1:111920589-111920611 GGGCAGCTGCAGCCCCTGTGGGG + Intronic
913222079 1:116667715-116667737 CGGCACCAGCAGCCGCGCTGCGG + Exonic
914197409 1:145454635-145454657 CGGCGGCGGCTGCGGCGGTGGGG - Intergenic
915913570 1:159928708-159928730 TAGCAGCAGCAGCCCCAGTGGGG - Exonic
916761310 1:167820257-167820279 CGGCGCCAGCAGCCCTGTGGTGG - Intronic
917876891 1:179294016-179294038 TGGCGGCAGCAGCTCCGGCCCGG + Intronic
918078761 1:181190136-181190158 GGGCCCCAGCAGCCCCGCTGCGG - Intergenic
920756756 1:208740089-208740111 CTCCACCAGCAGCCCCGGTGCGG + Intergenic
921384129 1:214552094-214552116 CGGCGGGAGCAGCCCAGGGTTGG - Intronic
922218491 1:223539873-223539895 TGGCAGCAGAAGCCCCAGTGGGG - Intronic
922696790 1:227734983-227735005 CGGCGGCCGCAGACCCCGGGCGG - Exonic
922958691 1:229626262-229626284 CGGCGGCTGCTGTCCCGGTGCGG - Exonic
1063338032 10:5235269-5235291 CAGAGGCAGCAGCCCCAGTCAGG + Intergenic
1064103039 10:12479519-12479541 CGGCAGCAGCAGCACTGCTGGGG - Intronic
1065025303 10:21534862-21534884 CGGCGGTTGCGGCCCAGGTGGGG - Intronic
1069424682 10:68279039-68279061 TGGCGGCAGCAGCGGCGGCGGGG + Intergenic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071695404 10:87863987-87864009 CGGCGGCTGCAGCTCCAGGGAGG + Exonic
1072591654 10:96832831-96832853 CGGCGGCCACAGCGCGGGTGGGG - Intronic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1076595509 10:131622598-131622620 AGGCGGCAGCAGCTCCTGGGAGG - Intergenic
1076851269 10:133094501-133094523 CGGCCACAGCAGCCCCAGGGAGG + Intronic
1077091853 11:782254-782276 AGGGTGCAGCAGCCCCGGGGAGG + Intronic
1077502353 11:2915072-2915094 CGGGGGCAGCAGCACAGGTGGGG + Intronic
1083669524 11:64292266-64292288 CGGGGGCTGTCGCCCCGGTGTGG + Intronic
1083945068 11:65919103-65919125 CGGCCGCAGCGGCCGCGCTGTGG + Exonic
1085784783 11:79440010-79440032 CGGCTGCAGCAGCCCCGCACGGG - Intronic
1088991037 11:114953886-114953908 TGGCGGCAGCAGCCTGGATGGGG - Intergenic
1091219318 11:133920793-133920815 CAGCAGCAGCAGCCCTGGGGAGG - Exonic
1092860735 12:12717289-12717311 CGGCGGGAGCCGCCCCGCCGAGG - Exonic
1092905964 12:13101133-13101155 CGGCGCCAGCAGGCCGGCTGGGG + Intronic
1095727391 12:45469065-45469087 GGGCGGCTGTAGCCCCGCTGAGG - Intergenic
1096241396 12:49961979-49962001 CGGCGGCAGCTGCCGCGGCGGGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096537426 12:52284159-52284181 CAGCAGCAGCAGCCCCTGTCAGG - Intronic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1097043323 12:56169558-56169580 CGGCGGCAGCAGCGGTGGAGAGG + Exonic
1097664917 12:62467213-62467235 CGGCACCAGCAGCCCCGAGGCGG + Exonic
1097712784 12:62934273-62934295 CGGCGTCTCCAGCCCCGGTATGG - Intronic
1098105988 12:67069377-67069399 CAGCGGCGGCTGCCGCGGTGTGG + Intergenic
1098985123 12:77003989-77004011 TGGCAGCAGCAGCCTCAGTGAGG + Intergenic
1100211813 12:92406488-92406510 AGGCGCCTGCAGCCCCGGTGCGG - Intergenic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1102351935 12:112199080-112199102 CGGCCGCAGGAGCCCTGCTGTGG + Intronic
1103705005 12:122866684-122866706 CGGCCACTGCAGCCCTGGTGAGG - Exonic
1108542013 13:51453451-51453473 TGGCGTCAGCCGCCCCTGTGAGG + Intronic
1110273498 13:73617139-73617161 GGGCAGCAGCAGCTGCGGTGTGG - Intergenic
1111951252 13:94711297-94711319 CGGCGGCTGCAGCCCGGGGCTGG + Exonic
1112325797 13:98442135-98442157 CGACTGCAGCAGCCCCGCAGAGG - Intronic
1112504699 13:99968891-99968913 CGGGGGCAGCAGCGTCGGGGTGG - Intronic
1113379039 13:109786420-109786442 CGGCGGCAGCAGCCCCGGTGCGG - Exonic
1114272198 14:21107705-21107727 CAGCAGCAGCAGCCCAGGTCAGG - Intergenic
1117875887 14:60249611-60249633 CGGCGGCGGCAGCCGGGGAGGGG - Intronic
1118293848 14:64550358-64550380 CGGGGGAAGCAGCCCCGCTCTGG + Intronic
1121243624 14:92447440-92447462 AGGCGTCGGCAGCCCCGGGGAGG - Intronic
1121694008 14:95898018-95898040 TGGGGGCAGCAGCCCTGGAGAGG - Intergenic
1122108797 14:99480909-99480931 CGGCGGCTGCGGCCCGGGGGCGG - Intergenic
1122799173 14:104221293-104221315 CGGCTCCAGGAGCTCCGGTGGGG - Intergenic
1122880484 14:104688636-104688658 CGGCGCCAGCACTCCCTGTGCGG - Intergenic
1123964084 15:25438501-25438523 CGGCCGCCGCAGCCCAGGCGCGG - Exonic
1126668433 15:51094730-51094752 CGGCGGCAGCGGCCAGGGGGCGG + Intronic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128321997 15:66701091-66701113 CGGCGGCCCCACCCCCGGCGCGG - Intergenic
1128651150 15:69414591-69414613 CGGCCGCAGCAGCACCGGGCGGG - Intronic
1128764026 15:70240068-70240090 CAGGGGCAGAAGCCCGGGTGTGG - Intergenic
1129516988 15:76162973-76162995 GGACAGCAGGAGCCCCGGTGGGG - Intronic
1129853774 15:78810610-78810632 CCGCGCCAGCAGCCCAGATGCGG + Intronic
1129880723 15:79004503-79004525 AGGCGGGAGCAGGCCCTGTGTGG - Intronic
1130224237 15:82045633-82045655 CGGCGGCGGCAGCAGCGGAGGGG - Exonic
1130700577 15:86176422-86176444 CAGTGGCAGCAGCCCCAGTCAGG + Intronic
1131832320 15:96361550-96361572 CGGCGGCGGCAGCCCGGGAGTGG + Intergenic
1131846039 15:96491781-96491803 CGCCACCTGCAGCCCCGGTGCGG - Intergenic
1132810685 16:1795211-1795233 CGGCTGCCGCAACCCTGGTGAGG - Intergenic
1132851537 16:2027010-2027032 CGGCCGCAGCGGCTCCGGCGCGG - Exonic
1132885644 16:2180929-2180951 CGGCGGCAGCAGCTGCGGGGTGG + Exonic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1133979534 16:10622859-10622881 CGGGGGCAGAAGCACCAGTGGGG + Intergenic
1134143590 16:11742685-11742707 CGGCGGCAGCAGCAGCAGCGAGG - Exonic
1135979769 16:27138801-27138823 TGGCGGCGGCAGCAGCGGTGTGG + Intergenic
1136032553 16:27514250-27514272 GGACGGCAGGAGCCCCGGCGGGG - Intronic
1137261180 16:46831165-46831187 CGGCGGCAGCAGCGACGGCTCGG + Exonic
1137617792 16:49857318-49857340 CGGCGGCGGCAGGCACGGCGCGG + Intronic
1137675735 16:50302973-50302995 TGGCTGCAGCTGCCCCCGTGGGG + Intronic
1138457896 16:57131843-57131865 CGGTGGCAGAAGCCCAGGAGAGG - Intronic
1138473469 16:57256873-57256895 CGGCGGCTTCAGCCCCAGAGGGG + Exonic
1139956354 16:70694919-70694941 CAGAGGCAGCAGACCCGGAGGGG + Intronic
1141312738 16:82930957-82930979 CAGCGGAAGCTGCCCCTGTGGGG - Intronic
1142000764 16:87662926-87662948 AGGCAGCAGCAGCCCCGAAGGGG - Intronic
1142128353 16:88421161-88421183 TGGGGGCAGGAGCCCAGGTGGGG + Intergenic
1142518533 17:489592-489614 CGGCAGCAGAAGCGCTGGTGTGG + Intergenic
1142549795 17:731986-732008 CGGCTGCAGCCGCTCCGGGGTGG - Intergenic
1142560438 17:806188-806210 CGGGGGCTGCAGCCCTGGGGAGG - Intronic
1142560455 17:806234-806256 CGGGGGCTGCAGCCCTGGGGAGG - Intronic
1144339747 17:14301688-14301710 CAGGAGCAGCAGCCCCGGCGCGG - Exonic
1144852657 17:18251843-18251865 AGGGGGCAGCAGGCCCAGTGAGG - Intronic
1145265143 17:21376468-21376490 AGGCGGCAGCAGTGGCGGTGTGG - Exonic
1146329708 17:31917276-31917298 CGGCAGCAGCTGCCGCGGAGAGG + Intergenic
1147743073 17:42679614-42679636 CGGCGGGGGCAGCCGCGGCGGGG + Exonic
1150108611 17:62479137-62479159 CGGCGGCGGCTGCCCGGGCGGGG + Exonic
1150236314 17:63595656-63595678 CGGCAGCAGCAGCCACGGCAAGG + Intergenic
1151403909 17:73874561-73874583 TGGAGGCAGGAGCCCAGGTGGGG - Intergenic
1151661731 17:75522484-75522506 CGGCTGCAGCAGGGCCTGTGTGG + Intronic
1151780139 17:76240246-76240268 CTGCGGCTGCAGCCCCGGCCCGG + Exonic
1153997435 18:10454521-10454543 CGGCGGCGGCTGCCCGGGGGCGG + Intergenic
1154175669 18:12086368-12086390 AGGTGGCAGCAGCCAGGGTGGGG + Intergenic
1157894271 18:51449054-51449076 CTGCGGCAGTAGCCCTGCTGAGG - Intergenic
1158404295 18:57147327-57147349 CGGCGGCGGCAGCGGCGGTGCGG + Exonic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160794910 19:940841-940863 AGGCGGGCGCTGCCCCGGTGGGG - Intronic
1160866182 19:1257164-1257186 GGGCGGCGGCAGCCCCAGCGAGG + Exonic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1161579562 19:5073363-5073385 GAGAGCCAGCAGCCCCGGTGGGG + Intronic
1161802631 19:6424545-6424567 CGGCGGCGGCGGCCCGGGCGGGG - Exonic
1162345187 19:10114589-10114611 CGGCAGCAGCAGCCCAGGCTGGG - Exonic
1163100909 19:15095807-15095829 AGGAGGGAGCAGCCCCTGTGTGG + Intergenic
1163262170 19:16197967-16197989 TGGCGGCGGCAGCGACGGTGGGG - Exonic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163702053 19:18790939-18790961 CGGCGGCAGGGGACCTGGTGAGG + Intronic
1163827647 19:19532637-19532659 CGGAGGCAGCCGCCCTGGAGCGG + Exonic
1164835302 19:31351705-31351727 CGGCGGGAGCTGACCCCGTGCGG - Intergenic
1164958326 19:32405736-32405758 GGGCGTCAACAGCCCCGGGGAGG - Intronic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1165319602 19:35077020-35077042 CGGTGGCAGAGGCCCTGGTGCGG + Intergenic
1165349516 19:35268499-35268521 CGGCGGCGCGAGCCCCGGGGCGG - Intergenic
1165772126 19:38386023-38386045 CGGCGCCAGCAGGGCAGGTGCGG + Exonic
1166316869 19:41994218-41994240 CGGCCGCCGCAGCCTCTGTGCGG - Exonic
1166921440 19:46231514-46231536 CATCGGGAGCAGCCCAGGTGGGG + Intergenic
1167258239 19:48443477-48443499 CGGCGGCAGCAGCTCCAGGCTGG - Exonic
1167333798 19:48872606-48872628 CGGGGGCAGGAGCGCCGGTTCGG - Exonic
1168247002 19:55117481-55117503 CGGCGGCGGCTGCCCGGGAGCGG - Exonic
1168607235 19:57769844-57769866 TGGCGGCAGCAGCCGCTCTGAGG + Exonic
926008738 2:9392315-9392337 CTGCTGCAGCAGCCCTGGAGTGG + Intronic
927937119 2:27082366-27082388 TGGCGGCAGCAGCAGCAGTGGGG + Exonic
928511921 2:32010566-32010588 CGGCGGAACCAGCCCCGGCTGGG - Intronic
931694252 2:64859956-64859978 TGGCGGCCGCAGCCCCGGGGCGG + Intergenic
932036536 2:68252202-68252224 CGGCGGCGGCGGCCCAGCTGCGG + Exonic
932567732 2:72920148-72920170 CGGAGGCAGGAACCGCGGTGCGG - Intronic
933684725 2:85133738-85133760 CGGCGGCTCCAGCGCCGGGGCGG + Exonic
933747943 2:85584477-85584499 CGGCGGCAGCAGCGATGGTGAGG + Exonic
934251575 2:90360037-90360059 GGGCTGCAGCAGCCCAGGAGCGG + Intergenic
934257984 2:91443361-91443383 GGGCTGCAGCAGCCCAGGAGCGG - Intergenic
935997166 2:108786894-108786916 CGGGGGCAGCTGCCCCGACGAGG + Exonic
937844085 2:126558232-126558254 CGGCGGCGGCAGCAGCGGCGAGG + Intergenic
938302955 2:130229177-130229199 CGGTGCGGGCAGCCCCGGTGGGG - Intergenic
938453711 2:131445045-131445067 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
940421004 2:153478872-153478894 CGGCGGCTGCAGCGGCGGGGTGG + Intergenic
942241026 2:173964399-173964421 CGGCAGCGGCGGCCCAGGTGAGG - Exonic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
943276776 2:185877034-185877056 CGCAGGCAGCAGCCCTGATGAGG - Intergenic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
946692403 2:222319472-222319494 CGGCGGCGGCGGCTGCGGTGGGG + Intergenic
948488543 2:238296820-238296842 CGGTGGCTGCAGCCTTGGTGGGG - Intergenic
1168957544 20:1844901-1844923 CGGCAGCAGCAGCCCCAGAAGGG - Intergenic
1169197479 20:3691364-3691386 CAGAGGCAGCAGCCCCAGTGGGG + Exonic
1170924742 20:20712588-20712610 CGGCGGCAGCAGCGGGGCTGGGG - Intergenic
1172428575 20:34872690-34872712 CGGCGCCCGCGGCCCCGCTGAGG - Exonic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1176002005 20:62836426-62836448 TGGGGGCGGCAGCCTCGGTGAGG - Intronic
1176005548 20:62860868-62860890 GGGCGGCCCCAGACCCGGTGAGG + Intronic
1176257337 20:64159178-64159200 GGGCGGCAGCACCCCCTGAGAGG - Intronic
1177166790 21:17612693-17612715 CGGCGGCGGCAGCGGCGGTGAGG - Exonic
1177431707 21:20998302-20998324 CGGCGGCAGCAGAGCCGGGCGGG - Exonic
1177442655 21:21147160-21147182 CAGCGGTACCAGCTCCGGTGTGG - Intronic
1178585577 21:33868266-33868288 CTCCAGCTGCAGCCCCGGTGTGG - Intronic
1178983284 21:37283134-37283156 CTCCAGCTGCAGCCCCGGTGTGG - Intergenic
1179475317 21:41639515-41639537 CGGAGGCAGCAGGCCTGGGGTGG - Intergenic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1181177371 22:21045359-21045381 GGGCAGCAACAGCCCCGGGGGGG + Intergenic
1181934616 22:26429595-26429617 CGGCGGCGGCGGCGCCGGTAAGG - Intronic
1182435454 22:30326917-30326939 CGGCGGCAGCAGGGCGGCTGAGG - Intronic
1182510799 22:30818782-30818804 CAGGAGCAGCAGCCCAGGTGGGG + Intronic
1183655025 22:39179640-39179662 CTGGGCCAGCAGCCCTGGTGAGG + Intergenic
1184545335 22:45163767-45163789 CGGCGCCAGCAGCCGCGCTTTGG - Intergenic
1184711262 22:46250687-46250709 CGGGGGCAGACGTCCCGGTGGGG - Intergenic
1203324993 22_KI270738v1_random:4919-4941 AGGCGGCAGCGGCCCAGGAGCGG + Intergenic
951485287 3:23203240-23203262 CGGCGGCAGCGGCGGCGCTGAGG + Intronic
953547203 3:43872375-43872397 AGGGGGCAGCAGCCCAGGTGGGG - Intergenic
954152083 3:48662708-48662730 CGGCGGCAGGGGCCCGGGAGGGG - Exonic
954304490 3:49718231-49718253 CGGCGGCAGCAGCGGCAGGGTGG + Exonic
954912655 3:54122275-54122297 CGGCCGCAGTAGCCCGGGTGGGG + Intergenic
955359524 3:58261026-58261048 TGGCCACAGCATCCCCGGTGTGG - Intronic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
960937605 3:122913120-122913142 CGGGGGCGGGAGCCCCGGGGAGG - Intronic
966015288 3:175132288-175132310 CGGGGGCAGCTGGCCGGGTGGGG + Intronic
966696451 3:182794061-182794083 TGGCCACAGCAGCCCCGGAGCGG - Intronic
968353403 3:198080970-198080992 CGGCGGCGGCTGCACCGGGGCGG - Intergenic
968452368 4:681575-681597 CGGCGGCTGCAGCCACAGTCTGG - Intronic
972585360 4:40432716-40432738 CGGCGGCAGCAGCACTGGCTGGG + Exonic
976830338 4:89307852-89307874 CGGCGTCTGCAGCCCCGCGGTGG - Exonic
979290745 4:118976998-118977020 CTCCAGCTGCAGCCCCGGTGCGG - Intronic
982856345 4:160386240-160386262 CGGCTGCAGCAGGCGAGGTGTGG - Intergenic
983380271 4:166982221-166982243 TGGCGGCAGCAGCCCATCTGGGG - Intronic
983923423 4:173371212-173371234 CGGCGGCCGCATCCCCGCCGCGG - Exonic
983940265 4:173529487-173529509 CGGCGGCCGCAGCGCTGCTGAGG - Exonic
985573045 5:660769-660791 CGGCCGCAGCAGCCCAGGATGGG + Exonic
988587888 5:32523600-32523622 AGTAGGCAGCAGTCCCGGTGTGG - Intergenic
989710381 5:44389650-44389672 CGGCCGCAACAGCCGCGGCGAGG - Intronic
990041565 5:51383441-51383463 CGGCGGCGGCAGACTCGGCGCGG - Exonic
990557633 5:56951855-56951877 CGGCGGCTCCGGCCCCGGTCGGG - Intronic
997292483 5:132747704-132747726 CGTCCGCAGCAGTCCCCGTGCGG + Exonic
998236430 5:140402150-140402172 CGGCGGCAGCGGCAGCGGTACGG + Exonic
1001109401 5:168883417-168883439 CAGAGGCAGCAGCCTGGGTGGGG - Intronic
1002385062 5:178860284-178860306 CGTCGGCAGCGGCACCGGAGCGG - Intronic
1002784740 6:392462-392484 CGGGGGCTGCAGCCCCAGTACGG - Intronic
1002789307 6:426148-426170 CTCCGCCTGCAGCCCCGGTGCGG - Intergenic
1003049417 6:2766050-2766072 CGGCGGCCGCCGCCGCGGCGGGG + Exonic
1004865981 6:19854381-19854403 CTCCGCCTGCAGCCCCGGTGCGG - Intergenic
1005896298 6:30182062-30182084 TGGCGGCAGCAGCCCCAGCCAGG + Intergenic
1006136222 6:31897630-31897652 CGGCGGCGGCCGCCGAGGTGCGG - Exonic
1006640432 6:35486620-35486642 CGCCAGCAGCAGCCCCGGGGAGG - Exonic
1006911361 6:37565773-37565795 CGGCAGCAGCAGCCTCAGGGAGG - Intergenic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1015149272 6:130019997-130020019 CGGCGGCGGCCGCGCCGGGGCGG + Intronic
1019663372 7:2238548-2238570 CGGACGGAGCAGCCCCAGTGGGG + Intronic
1019989558 7:4682256-4682278 CGGCGGCTGCAGCGGCGGCGCGG - Intergenic
1020030472 7:4929320-4929342 CGGCCGCAGCAGCCTCGCAGGGG + Intronic
1020096875 7:5374365-5374387 CCGCGGCAGCAGCCCGGGGCCGG + Exonic
1022021044 7:26399293-26399315 CGGCAGTTGCAGCCCTGGTGAGG + Intergenic
1022207657 7:28179929-28179951 CGGCGGCTGCAGCCGCGGGGAGG - Intronic
1022275689 7:28853878-28853900 ACGCCGCAGCAGCCCGGGTGTGG + Intergenic
1022722992 7:32957449-32957471 TGGCGGCTGCAGCCCGGGTAGGG + Exonic
1027001570 7:74657984-74658006 CGGCGGCCGCAGCCCGCGCGCGG + Intronic
1027218912 7:76201914-76201936 CGGCGGCAGCACCCGCGGGGAGG + Exonic
1029435649 7:100562651-100562673 CGGCGGCAGCAGCACAGGGCTGG + Exonic
1029439032 7:100577300-100577322 CGGCGGCAGCAGCAGCAGAGCGG - Exonic
1031966642 7:128031972-128031994 CGGCGGCAGCAGCAGCAGCGGGG + Intronic
1034155683 7:148954613-148954635 TGCAGGCAGCAGCCGCGGTGAGG - Intergenic
1034243093 7:149624536-149624558 AGGCGGCCGCAGCTCCGGTAAGG - Intergenic
1035169713 7:157010637-157010659 CGGCGGCAGCGGCCTCCGCGCGG - Exonic
1035266493 7:157692673-157692695 GGGCTGCAGGAGGCCCGGTGCGG + Intronic
1037900998 8:22689709-22689731 CGGCGGCAGCAGCACCGCGTCGG + Exonic
1038163706 8:25064436-25064458 GGGCGGCAGCAGCCCCAGGCTGG + Intergenic
1041109404 8:54470524-54470546 CGGCGTCAGCTGCCCCGGCGCGG - Intergenic
1041694548 8:60721675-60721697 CGGCAGCATCAGCACCGCTGGGG - Intronic
1042902832 8:73746345-73746367 CGGCGAGTGCAGCCACGGTGTGG - Intronic
1045305228 8:100951985-100952007 CGGCGGCGGCAGCAGCGGCGAGG + Exonic
1047418935 8:124690144-124690166 CGGCGGGAGCAGCAGCAGTGGGG - Intronic
1049500383 8:142959889-142959911 CTGCACCTGCAGCCCCGGTGCGG + Intergenic
1049682650 8:143926550-143926572 AGGCGGCACCAGCCACTGTGGGG + Intronic
1049788400 8:144462231-144462253 CGGGGGCTGCAGCCCCGGGCTGG + Intronic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1052888863 9:33677116-33677138 CGGCGGCTGCAGCTCCAGGGAGG - Intergenic
1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG + Exonic
1057572967 9:96218262-96218284 CGGCGGGCTCAGCGCCGGTGGGG + Intergenic
1057600141 9:96450489-96450511 CGGCGGCAGGAGCCCAGCCGGGG + Exonic
1057740775 9:97709550-97709572 CGGCTGCAGCAGGCCCAGTGAGG + Intergenic
1061293509 9:129665538-129665560 CAGCGCCAGCAGCCGGGGTGGGG + Intergenic
1061486307 9:130922231-130922253 CAGTGGCAGCAGCCCTGGGGCGG + Intronic
1061873868 9:133534509-133534531 CGGCGGCGGCGGCCCAGGAGCGG - Intronic
1062269223 9:135701068-135701090 CGGCGGCACCCGCCCAGGGGTGG + Intergenic
1062696271 9:137877790-137877812 CGGCGGCGGCTGCGGCGGTGGGG + Exonic
1186107926 X:6226762-6226784 CGGAGGGAGCAGCCGCGGAGTGG + Intronic
1186221987 X:7359076-7359098 CGGAGGGAGCAGCCTCTGTGTGG - Intergenic
1187915420 X:24149382-24149404 CGGCGGCAGCGGCGCGTGTGTGG + Intronic
1189324659 X:40105295-40105317 CGGCGGCAGCAGCCAGGGGAGGG + Intronic
1195154941 X:102113562-102113584 TGGCAGCAGCAGCCCTGTTGTGG + Intergenic
1196477743 X:116108471-116108493 AGGCGGCAGTGGCGCCGGTGAGG - Intergenic
1198683328 X:139204245-139204267 CGGCGGCGGCGGCAGCGGTGGGG - Intronic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1200154536 X:153968453-153968475 AGGGGGCAGAAACCCCGGTGAGG + Intronic