ID: 1113379093

View in Genome Browser
Species Human (GRCh38)
Location 13:109786697-109786719
Sequence CCGAGCGCGCCGTCCGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113379093_1113379105 5 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379105 13:109786725-109786747 CGGCGCGGCGCTCGCGGGGGCGG 0: 1
1: 0
2: 9
3: 51
4: 557
1113379093_1113379106 6 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379106 13:109786726-109786748 GGCGCGGCGCTCGCGGGGGCGGG 0: 1
1: 1
2: 6
3: 94
4: 580
1113379093_1113379099 -10 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379099 13:109786710-109786732 GCGCGCTCGGCCAATCGGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 28
1113379093_1113379103 1 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379103 13:109786721-109786743 CAATCGGCGCGGCGCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 24
1113379093_1113379102 0 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379102 13:109786720-109786742 CCAATCGGCGCGGCGCTCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1113379093_1113379100 -1 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379100 13:109786719-109786741 GCCAATCGGCGCGGCGCTCGCGG 0: 1
1: 0
2: 1
3: 8
4: 31
1113379093_1113379104 2 Left 1113379093 13:109786697-109786719 CCCCCGACGGACGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1113379104 13:109786722-109786744 AATCGGCGCGGCGCTCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113379093 Original CRISPR CCGAGCGCGCCGTCCGTCGG GGG (reversed) Intergenic
900204885 1:1427524-1427546 CCGGGCGGGCCGTCAGTGGGGGG - Intronic
901022155 1:6260976-6260998 CGGAGCGCGCCGGCCGCCGGTGG - Intergenic
901704039 1:11060159-11060181 TGTGGCGCGCCGTCCGTCGGCGG + Intergenic
902861707 1:19251606-19251628 CCGAGCGTCCCGTCCGACCGAGG - Exonic
904837531 1:33349255-33349277 CCGAACGCACCGTCCGTCCCAGG + Intronic
905442736 1:38005409-38005431 CCGGGCGCCGCGTCCCTCGGCGG + Exonic
915195012 1:154182877-154182899 CCGAGCCCGCCGGCCTTCAGAGG + Intronic
919486883 1:198157184-198157206 CCCAGCGCGCTTTCCGACGGCGG + Exonic
922025039 1:221742141-221742163 CCCAACCCGCCGTCGGTCGGCGG - Exonic
1084636856 11:70398619-70398641 GCGAGCGCGGCGTCCGCCCGGGG + Intronic
1093164566 12:15789785-15789807 CCGAGCGCTCCCTCCGCCCGGGG - Intronic
1095476218 12:42589679-42589701 CCGGGCGCGCTGTCGGGCGGCGG + Intronic
1104908832 12:132229872-132229894 CCAAGGTCACCGTCCGTCGGTGG + Intronic
1112415514 13:99200765-99200787 CCGGGTGCGCCGTTCGTCAGCGG + Exonic
1113379093 13:109786697-109786719 CCGAGCGCGCCGTCCGTCGGGGG - Intergenic
1127867253 15:63042762-63042784 GCGAGCGCGCGGTCGGGCGGAGG - Exonic
1128119179 15:65133381-65133403 CCGAGCACGTCGGCCGGCGGCGG + Exonic
1129710750 15:77819275-77819297 CCGGGCGCGCCGTCCGCGCGCGG + Intronic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1140046122 16:71441613-71441635 GCGAGCGCGCCGGCCGCCAGGGG + Intergenic
1142795478 17:2303782-2303804 GCGCGCGCGCCGCCCGTCTGTGG - Exonic
1145034924 17:19534168-19534190 CCGAGCGAGCTGTCCGCCGGCGG + Intronic
1152552131 17:81035129-81035151 CAGAGCCCGGCGTCCGGCGGCGG - Intronic
1165419961 19:35717818-35717840 CCGAGGGCGCCGGCCGGCCGCGG + Intergenic
937596583 2:123682232-123682254 CCGAGCCGGCCGTCCTTCCGGGG - Intergenic
1176194799 20:63831935-63831957 CCGCGCGCGCCTACCCTCGGGGG + Intergenic
1184680792 22:46071341-46071363 CCGCGCGCGCCGTCCCGGGGTGG + Intronic
954031876 3:47825364-47825386 CCAAGTTCGCCATCCGTCGGCGG + Intronic
963525712 3:146411523-146411545 CCGAGCCAGCCGTCCTTCCGGGG + Intronic
965104664 3:164341303-164341325 CCGAGCCGGCCGTCCTTCCGGGG + Intergenic
971257888 4:25030728-25030750 CCGAGCGCGCGGCGCGGCGGTGG - Exonic
1011355952 6:86473612-86473634 CCGAGCCAGCCGTCCTTCTGGGG - Intergenic
1019279710 7:193549-193571 CCGAGCGCGCCTTGCGGGGGCGG + Exonic
1022923262 7:35037189-35037211 CCCGGCGCGCCGCCCGCCGGGGG - Intronic
1031918573 7:127585269-127585291 GCGAGCGGGCTGTCCGGCGGCGG + Exonic
1035361882 7:158318656-158318678 CCGAGAGCGCCTTCCTTCTGAGG - Intronic
1056163423 9:83920776-83920798 CCGAGAGCTCCCTCCCTCGGAGG - Intronic
1060416299 9:123432964-123432986 CAGAGCGCGCAGTCCCTCAGGGG - Intronic
1061000527 9:127899695-127899717 CCGCCCGCGCCGCCCGTGGGCGG - Intronic
1190390031 X:49922733-49922755 CCGAGCGCGCTGCCCACCGGCGG + Exonic