ID: 1113379117

View in Genome Browser
Species Human (GRCh38)
Location 13:109786767-109786789
Sequence CGCGGCCCGGGGAGAAAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 232}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113379117_1113379138 20 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379138 13:109786810-109786832 CTCCCGCGAAGGCCCCGGCCCGG 0: 1
1: 1
2: 2
3: 17
4: 166
1113379117_1113379143 28 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379143 13:109786818-109786840 AAGGCCCCGGCCCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 23
4: 300
1113379117_1113379129 9 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379129 13:109786799-109786821 GTCCCCTCCCCCTCCCGCGAAGG 0: 1
1: 1
2: 2
3: 19
4: 298
1113379117_1113379133 15 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379133 13:109786805-109786827 TCCCCCTCCCGCGAAGGCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 211
1113379117_1113379141 24 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379141 13:109786814-109786836 CGCGAAGGCCCCGGCCCGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 185
1113379117_1113379144 29 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379144 13:109786819-109786841 AGGCCCCGGCCCGGCCGGGCGGG 0: 1
1: 0
2: 4
3: 68
4: 644
1113379117_1113379145 30 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379145 13:109786820-109786842 GGCCCCGGCCCGGCCGGGCGGGG 0: 1
1: 1
2: 14
3: 172
4: 999
1113379117_1113379142 25 Left 1113379117 13:109786767-109786789 CCCCCCTTTCTCCCCGGGCCGCG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1113379142 13:109786815-109786837 GCGAAGGCCCCGGCCCGGCCGGG 0: 1
1: 0
2: 2
3: 37
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113379117 Original CRISPR CGCGGCCCGGGGAGAAAGGG GGG (reversed) Intergenic