ID: 1113380196

View in Genome Browser
Species Human (GRCh38)
Location 13:109797077-109797099
Sequence ATGCAAGTTCAGCTGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113380192_1113380196 15 Left 1113380192 13:109797039-109797061 CCCGGCCGGTAGGTTGAGTTTTA No data
Right 1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG No data
1113380191_1113380196 23 Left 1113380191 13:109797031-109797053 CCATCGTGCCCGGCCGGTAGGTT No data
Right 1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG No data
1113380195_1113380196 10 Left 1113380195 13:109797044-109797066 CCGGTAGGTTGAGTTTTAATGGT No data
Right 1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG No data
1113380193_1113380196 14 Left 1113380193 13:109797040-109797062 CCGGCCGGTAGGTTGAGTTTTAA No data
Right 1113380196 13:109797077-109797099 ATGCAAGTTCAGCTGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113380196 Original CRISPR ATGCAAGTTCAGCTGTAGCC TGG Intergenic
No off target data available for this crispr