ID: 1113383079

View in Genome Browser
Species Human (GRCh38)
Location 13:109821272-109821294
Sequence CAGGAAGAGCAGATGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113383079_1113383089 10 Left 1113383079 13:109821272-109821294 CCTCCCTGCATCTGCTCTTCCTG No data
Right 1113383089 13:109821305-109821327 TGCACTTCTCTCTGGGGTCACGG No data
1113383079_1113383087 4 Left 1113383079 13:109821272-109821294 CCTCCCTGCATCTGCTCTTCCTG No data
Right 1113383087 13:109821299-109821321 TCCAGGTGCACTTCTCTCTGGGG No data
1113383079_1113383090 20 Left 1113383079 13:109821272-109821294 CCTCCCTGCATCTGCTCTTCCTG No data
Right 1113383090 13:109821315-109821337 TCTGGGGTCACGGCTTTGCCTGG No data
1113383079_1113383086 3 Left 1113383079 13:109821272-109821294 CCTCCCTGCATCTGCTCTTCCTG No data
Right 1113383086 13:109821298-109821320 CTCCAGGTGCACTTCTCTCTGGG No data
1113383079_1113383085 2 Left 1113383079 13:109821272-109821294 CCTCCCTGCATCTGCTCTTCCTG No data
Right 1113383085 13:109821297-109821319 ACTCCAGGTGCACTTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113383079 Original CRISPR CAGGAAGAGCAGATGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr