ID: 1113384512

View in Genome Browser
Species Human (GRCh38)
Location 13:109836339-109836361
Sequence TTTTGTCATTAGAAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113384512_1113384515 -4 Left 1113384512 13:109836339-109836361 CCATCCACTTTCTAATGACAAAA No data
Right 1113384515 13:109836358-109836380 AAAACTGTTCTATGCATCAAGGG No data
1113384512_1113384514 -5 Left 1113384512 13:109836339-109836361 CCATCCACTTTCTAATGACAAAA No data
Right 1113384514 13:109836357-109836379 CAAAACTGTTCTATGCATCAAGG No data
1113384512_1113384517 21 Left 1113384512 13:109836339-109836361 CCATCCACTTTCTAATGACAAAA No data
Right 1113384517 13:109836383-109836405 TTGCATTCTGATCCACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113384512 Original CRISPR TTTTGTCATTAGAAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr