ID: 1113386040

View in Genome Browser
Species Human (GRCh38)
Location 13:109849146-109849168
Sequence CTGCATGTGTAGAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113386037_1113386040 2 Left 1113386037 13:109849121-109849143 CCTTTAGACAGAGAAACCTTTAA No data
Right 1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113386040 Original CRISPR CTGCATGTGTAGAAGGATGA TGG Intergenic
No off target data available for this crispr