ID: 1113389131

View in Genome Browser
Species Human (GRCh38)
Location 13:109879004-109879026
Sequence TATGGGAATTTGCAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113389126_1113389131 10 Left 1113389126 13:109878971-109878993 CCAAAGGAAAATGGAAAGGAATT No data
Right 1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG No data
1113389123_1113389131 23 Left 1113389123 13:109878958-109878980 CCTAATTTTTTTTCCAAAGGAAA No data
Right 1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113389131 Original CRISPR TATGGGAATTTGCAGCTGGT GGG Intergenic
No off target data available for this crispr