ID: 1113390267

View in Genome Browser
Species Human (GRCh38)
Location 13:109889776-109889798
Sequence CAGGGTAGAGGGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5198
Summary {0: 2, 1: 22, 2: 245, 3: 1426, 4: 3503}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113390260_1113390267 -10 Left 1113390260 13:109889763-109889785 CCAGGGCCTACTTCAGGGTAGAG No data
Right 1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG 0: 2
1: 22
2: 245
3: 1426
4: 3503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113390267 Original CRISPR CAGGGTAGAGGGTAGGAGGA GGG Intergenic
Too many off-targets to display for this crispr