ID: 1113393058

View in Genome Browser
Species Human (GRCh38)
Location 13:109916353-109916375
Sequence GGTGTAGTCACTCTGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393058_1113393064 7 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393064 13:109916383-109916405 CAATGGAACTGGTGTGTCACTGG No data
1113393058_1113393067 30 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393067 13:109916406-109916428 GGTTTAGCATCATTGCTTCACGG No data
1113393058_1113393065 8 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393065 13:109916384-109916406 AATGGAACTGGTGTGTCACTGGG No data
1113393058_1113393066 9 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393066 13:109916385-109916407 ATGGAACTGGTGTGTCACTGGGG No data
1113393058_1113393061 -10 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393058_1113393062 -4 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393062 13:109916372-109916394 CACCTGAGGGACAATGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393058 Original CRISPR GGTGTAGTCACTCTGAAGCC TGG (reversed) Intergenic