ID: 1113393061

View in Genome Browser
Species Human (GRCh38)
Location 13:109916366-109916388
Sequence TGACTACACCTGAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393057_1113393061 -9 Left 1113393057 13:109916352-109916374 CCCAGGCTTCAGAGTGACTACAC No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393054_1113393061 21 Left 1113393054 13:109916322-109916344 CCCATGGAAACTCTGGGAAACAA No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393055_1113393061 20 Left 1113393055 13:109916323-109916345 CCATGGAAACTCTGGGAAACAAT No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393058_1113393061 -10 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393053_1113393061 22 Left 1113393053 13:109916321-109916343 CCCCATGGAAACTCTGGGAAACA No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data
1113393050_1113393061 30 Left 1113393050 13:109916313-109916335 CCTTTGCTCCCCATGGAAACTCT No data
Right 1113393061 13:109916366-109916388 TGACTACACCTGAGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393061 Original CRISPR TGACTACACCTGAGGGACAA TGG Intergenic
No off target data available for this crispr