ID: 1113393063

View in Genome Browser
Species Human (GRCh38)
Location 13:109916374-109916396
Sequence CACCAGTTCCATTGTCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393063_1113393068 12 Left 1113393063 13:109916374-109916396 CCTGAGGGACAATGGAACTGGTG No data
Right 1113393068 13:109916409-109916431 TTAGCATCATTGCTTCACGGTGG No data
1113393063_1113393069 19 Left 1113393063 13:109916374-109916396 CCTGAGGGACAATGGAACTGGTG No data
Right 1113393069 13:109916416-109916438 CATTGCTTCACGGTGGTAGTAGG No data
1113393063_1113393067 9 Left 1113393063 13:109916374-109916396 CCTGAGGGACAATGGAACTGGTG No data
Right 1113393067 13:109916406-109916428 GGTTTAGCATCATTGCTTCACGG No data
1113393063_1113393070 20 Left 1113393063 13:109916374-109916396 CCTGAGGGACAATGGAACTGGTG No data
Right 1113393070 13:109916417-109916439 ATTGCTTCACGGTGGTAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393063 Original CRISPR CACCAGTTCCATTGTCCCTC AGG (reversed) Intergenic
No off target data available for this crispr