ID: 1113393064

View in Genome Browser
Species Human (GRCh38)
Location 13:109916383-109916405
Sequence CAATGGAACTGGTGTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393057_1113393064 8 Left 1113393057 13:109916352-109916374 CCCAGGCTTCAGAGTGACTACAC No data
Right 1113393064 13:109916383-109916405 CAATGGAACTGGTGTGTCACTGG No data
1113393058_1113393064 7 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393064 13:109916383-109916405 CAATGGAACTGGTGTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393064 Original CRISPR CAATGGAACTGGTGTGTCAC TGG Intergenic
No off target data available for this crispr