ID: 1113393065

View in Genome Browser
Species Human (GRCh38)
Location 13:109916384-109916406
Sequence AATGGAACTGGTGTGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393057_1113393065 9 Left 1113393057 13:109916352-109916374 CCCAGGCTTCAGAGTGACTACAC No data
Right 1113393065 13:109916384-109916406 AATGGAACTGGTGTGTCACTGGG No data
1113393058_1113393065 8 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393065 13:109916384-109916406 AATGGAACTGGTGTGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393065 Original CRISPR AATGGAACTGGTGTGTCACT GGG Intergenic
No off target data available for this crispr