ID: 1113393067

View in Genome Browser
Species Human (GRCh38)
Location 13:109916406-109916428
Sequence GGTTTAGCATCATTGCTTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393063_1113393067 9 Left 1113393063 13:109916374-109916396 CCTGAGGGACAATGGAACTGGTG No data
Right 1113393067 13:109916406-109916428 GGTTTAGCATCATTGCTTCACGG No data
1113393058_1113393067 30 Left 1113393058 13:109916353-109916375 CCAGGCTTCAGAGTGACTACACC No data
Right 1113393067 13:109916406-109916428 GGTTTAGCATCATTGCTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393067 Original CRISPR GGTTTAGCATCATTGCTTCA CGG Intergenic
No off target data available for this crispr