ID: 1113393365

View in Genome Browser
Species Human (GRCh38)
Location 13:109919301-109919323
Sequence CTCTTTTTGACTTGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393365_1113393367 -1 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393367 13:109919323-109919345 GAAACGCAGTCCAGACATGGTGG No data
1113393365_1113393371 30 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393371 13:109919354-109919376 TGTAATCCCAGCACTCTGGGAGG 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
1113393365_1113393366 -4 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393366 13:109919320-109919342 AGAGAAACGCAGTCCAGACATGG No data
1113393365_1113393369 26 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393369 13:109919350-109919372 CAACTGTAATCCCAGCACTCTGG 0: 27
1: 3104
2: 83654
3: 219372
4: 256591
1113393365_1113393370 27 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393370 13:109919351-109919373 AACTGTAATCCCAGCACTCTGGG 0: 30
1: 3287
2: 91065
3: 323224
4: 240497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393365 Original CRISPR CTCTTTTTGACTTGTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr