ID: 1113393367

View in Genome Browser
Species Human (GRCh38)
Location 13:109919323-109919345
Sequence GAAACGCAGTCCAGACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393365_1113393367 -1 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393367 13:109919323-109919345 GAAACGCAGTCCAGACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393367 Original CRISPR GAAACGCAGTCCAGACATGG TGG Intergenic
No off target data available for this crispr