ID: 1113393369

View in Genome Browser
Species Human (GRCh38)
Location 13:109919350-109919372
Sequence CAACTGTAATCCCAGCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 562748
Summary {0: 27, 1: 3104, 2: 83654, 3: 219372, 4: 256591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393368_1113393369 -6 Left 1113393368 13:109919333-109919355 CCAGACATGGTGGTTCACAACTG No data
Right 1113393369 13:109919350-109919372 CAACTGTAATCCCAGCACTCTGG 0: 27
1: 3104
2: 83654
3: 219372
4: 256591
1113393365_1113393369 26 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393369 13:109919350-109919372 CAACTGTAATCCCAGCACTCTGG 0: 27
1: 3104
2: 83654
3: 219372
4: 256591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393369 Original CRISPR CAACTGTAATCCCAGCACTC TGG Intergenic
Too many off-targets to display for this crispr