ID: 1113393370

View in Genome Browser
Species Human (GRCh38)
Location 13:109919351-109919373
Sequence AACTGTAATCCCAGCACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 658103
Summary {0: 30, 1: 3287, 2: 91065, 3: 323224, 4: 240497}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393365_1113393370 27 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393370 13:109919351-109919373 AACTGTAATCCCAGCACTCTGGG 0: 30
1: 3287
2: 91065
3: 323224
4: 240497
1113393368_1113393370 -5 Left 1113393368 13:109919333-109919355 CCAGACATGGTGGTTCACAACTG No data
Right 1113393370 13:109919351-109919373 AACTGTAATCCCAGCACTCTGGG 0: 30
1: 3287
2: 91065
3: 323224
4: 240497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393370 Original CRISPR AACTGTAATCCCAGCACTCT GGG Intergenic
Too many off-targets to display for this crispr