ID: 1113393371

View in Genome Browser
Species Human (GRCh38)
Location 13:109919354-109919376
Sequence TGTAATCCCAGCACTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 857663
Summary {0: 7837, 1: 299856, 2: 263617, 3: 151465, 4: 134888}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113393368_1113393371 -2 Left 1113393368 13:109919333-109919355 CCAGACATGGTGGTTCACAACTG No data
Right 1113393371 13:109919354-109919376 TGTAATCCCAGCACTCTGGGAGG 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
1113393365_1113393371 30 Left 1113393365 13:109919301-109919323 CCTGACACACAAGTCAAAAAGAG No data
Right 1113393371 13:109919354-109919376 TGTAATCCCAGCACTCTGGGAGG 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113393371 Original CRISPR TGTAATCCCAGCACTCTGGG AGG Intergenic
Too many off-targets to display for this crispr