ID: 1113394948

View in Genome Browser
Species Human (GRCh38)
Location 13:109938663-109938685
Sequence CTCGGCTAGTATCGAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113394944_1113394948 29 Left 1113394944 13:109938611-109938633 CCAACAGAATTCATAAAGCAAAT No data
Right 1113394948 13:109938663-109938685 CTCGGCTAGTATCGAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113394948 Original CRISPR CTCGGCTAGTATCGAAATAC AGG Intergenic
No off target data available for this crispr