ID: 1113397485

View in Genome Browser
Species Human (GRCh38)
Location 13:109962116-109962138
Sequence CTTCATAGTTTTGAACCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113397485_1113397493 29 Left 1113397485 13:109962116-109962138 CCTAATGGTTCAAAACTATGAAG No data
Right 1113397493 13:109962168-109962190 CAGTTACATGTCCAGTGGTGTGG No data
1113397485_1113397494 30 Left 1113397485 13:109962116-109962138 CCTAATGGTTCAAAACTATGAAG No data
Right 1113397494 13:109962169-109962191 AGTTACATGTCCAGTGGTGTGGG No data
1113397485_1113397490 24 Left 1113397485 13:109962116-109962138 CCTAATGGTTCAAAACTATGAAG No data
Right 1113397490 13:109962163-109962185 CCTCCCAGTTACATGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113397485 Original CRISPR CTTCATAGTTTTGAACCATT AGG (reversed) Intergenic
No off target data available for this crispr