ID: 1113397493

View in Genome Browser
Species Human (GRCh38)
Location 13:109962168-109962190
Sequence CAGTTACATGTCCAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113397485_1113397493 29 Left 1113397485 13:109962116-109962138 CCTAATGGTTCAAAACTATGAAG No data
Right 1113397493 13:109962168-109962190 CAGTTACATGTCCAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113397493 Original CRISPR CAGTTACATGTCCAGTGGTG TGG Intergenic
No off target data available for this crispr