ID: 1113406505

View in Genome Browser
Species Human (GRCh38)
Location 13:110045817-110045839
Sequence CTCTATCAGCAGATAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113406496_1113406505 28 Left 1113406496 13:110045766-110045788 CCCTTTCGCATTACCTCACCTCC No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406502_1113406505 -6 Left 1113406502 13:110045800-110045822 CCTTGTTTTCTGTAGAACTCTAT No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406501_1113406505 -5 Left 1113406501 13:110045799-110045821 CCCTTGTTTTCTGTAGAACTCTA No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406500_1113406505 7 Left 1113406500 13:110045787-110045809 CCTCAAGTCATTCCCTTGTTTTC No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406499_1113406505 10 Left 1113406499 13:110045784-110045806 CCTCCTCAAGTCATTCCCTTGTT No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406497_1113406505 27 Left 1113406497 13:110045767-110045789 CCTTTCGCATTACCTCACCTCCT No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data
1113406498_1113406505 15 Left 1113406498 13:110045779-110045801 CCTCACCTCCTCAAGTCATTCCC No data
Right 1113406505 13:110045817-110045839 CTCTATCAGCAGATAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113406505 Original CRISPR CTCTATCAGCAGATAGAGGA GGG Intergenic
No off target data available for this crispr