ID: 1113408950

View in Genome Browser
Species Human (GRCh38)
Location 13:110066739-110066761
Sequence ACCTTAAGACATGAACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113408947_1113408950 0 Left 1113408947 13:110066716-110066738 CCTGCCTTTCTTTTCCTTGAAAC No data
Right 1113408950 13:110066739-110066761 ACCTTAAGACATGAACAAAGTGG No data
1113408946_1113408950 25 Left 1113408946 13:110066691-110066713 CCATTCTAAGGAATGTCTTTCAC No data
Right 1113408950 13:110066739-110066761 ACCTTAAGACATGAACAAAGTGG No data
1113408945_1113408950 26 Left 1113408945 13:110066690-110066712 CCCATTCTAAGGAATGTCTTTCA No data
Right 1113408950 13:110066739-110066761 ACCTTAAGACATGAACAAAGTGG No data
1113408948_1113408950 -4 Left 1113408948 13:110066720-110066742 CCTTTCTTTTCCTTGAAACACCT No data
Right 1113408950 13:110066739-110066761 ACCTTAAGACATGAACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113408950 Original CRISPR ACCTTAAGACATGAACAAAG TGG Intergenic
No off target data available for this crispr