ID: 1113412824

View in Genome Browser
Species Human (GRCh38)
Location 13:110105321-110105343
Sequence CAGTCTGTGCCCTGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113412824_1113412829 12 Left 1113412824 13:110105321-110105343 CCCTGTTCCCAGGGCACAGACTG No data
Right 1113412829 13:110105356-110105378 CTCTCTTGAGAACTTAGCAAGGG No data
1113412824_1113412831 22 Left 1113412824 13:110105321-110105343 CCCTGTTCCCAGGGCACAGACTG No data
Right 1113412831 13:110105366-110105388 AACTTAGCAAGGGCAGGCAGAGG No data
1113412824_1113412828 11 Left 1113412824 13:110105321-110105343 CCCTGTTCCCAGGGCACAGACTG No data
Right 1113412828 13:110105355-110105377 GCTCTCTTGAGAACTTAGCAAGG No data
1113412824_1113412830 16 Left 1113412824 13:110105321-110105343 CCCTGTTCCCAGGGCACAGACTG No data
Right 1113412830 13:110105360-110105382 CTTGAGAACTTAGCAAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113412824 Original CRISPR CAGTCTGTGCCCTGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr