ID: 1113416385

View in Genome Browser
Species Human (GRCh38)
Location 13:110131646-110131668
Sequence GACACCGTTGTGCCTGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113416385_1113416389 -7 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416389 13:110131662-110131684 CGGTGTCTGCTTCTGAGGTGCGG No data
1113416385_1113416393 9 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416393 13:110131678-110131700 GGTGCGGGCCGCCTCCCGGAGGG No data
1113416385_1113416395 18 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416395 13:110131687-110131709 CGCCTCCCGGAGGGAACAGCAGG No data
1113416385_1113416392 8 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416392 13:110131677-110131699 AGGTGCGGGCCGCCTCCCGGAGG No data
1113416385_1113416390 -6 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416390 13:110131663-110131685 GGTGTCTGCTTCTGAGGTGCGGG No data
1113416385_1113416397 21 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416397 13:110131690-110131712 CTCCCGGAGGGAACAGCAGGCGG No data
1113416385_1113416391 5 Left 1113416385 13:110131646-110131668 CCGGACCCAGGCACAACGGTGTC No data
Right 1113416391 13:110131674-110131696 CTGAGGTGCGGGCCGCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113416385 Original CRISPR GACACCGTTGTGCCTGGGTC CGG (reversed) Intergenic
No off target data available for this crispr