ID: 1113418702

View in Genome Browser
Species Human (GRCh38)
Location 13:110152764-110152786
Sequence CTTTAAACTCTAATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113418702_1113418705 29 Left 1113418702 13:110152764-110152786 CCCAGCTTCATTAGAGTTTAAAG 0: 1
1: 1
2: 0
3: 22
4: 181
Right 1113418705 13:110152816-110152838 ACTCCAACCCATTCTAACATGGG 0: 1
1: 0
2: 1
3: 7
4: 121
1113418702_1113418704 28 Left 1113418702 13:110152764-110152786 CCCAGCTTCATTAGAGTTTAAAG 0: 1
1: 1
2: 0
3: 22
4: 181
Right 1113418704 13:110152815-110152837 CACTCCAACCCATTCTAACATGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113418702 Original CRISPR CTTTAAACTCTAATGAAGCT GGG (reversed) Intronic
903415033 1:23176817-23176839 CCTCAACCTCTCATGAAGCTGGG + Intronic
904244762 1:29179740-29179762 CTTTAAACTCTAGTAAAACTTGG - Intronic
907747443 1:57227433-57227455 CTTTAAAGAGTAATAAAGCTGGG + Intronic
907877012 1:58500489-58500511 CTTTATACTTTCAGGAAGCTAGG - Intronic
908248251 1:62244849-62244871 CTTTAAACGCTCATGAGGCCAGG - Intronic
908405445 1:63810034-63810056 CTTTAAACTCCATTGAACCTGGG - Intronic
908694845 1:66827398-66827420 CTTTAGCCTCTAAAGCAGCTGGG - Intronic
908740179 1:67319270-67319292 CTTTAAATTCTATTAAAGATAGG - Intronic
908769632 1:67584316-67584338 CTTTATAATCAAAAGAAGCTTGG - Intergenic
909395621 1:75168160-75168182 CTTTGAAGGCTAATGAAGCAAGG - Intergenic
910612314 1:89158170-89158192 CTTAAAACTCTAAATAAACTAGG + Intronic
911027747 1:93452674-93452696 CCTTAAGCTCTCAAGAAGCTGGG + Intronic
915159077 1:153903866-153903888 CTTTAACCTCTCAAGTAGCTGGG - Intronic
917074894 1:171194122-171194144 CTTTCAAGGCAAATGAAGCTAGG - Intronic
918210848 1:182349636-182349658 TTCTAAACTCTAATGAGTCTTGG + Intergenic
918543665 1:185658670-185658692 CTTTAAAGCCGAAAGAAGCTTGG - Intergenic
918609805 1:186475769-186475791 CTTTAGACTTTAATTATGCTAGG + Intergenic
919248800 1:195026176-195026198 CTAAAAGCTCTCATGAAGCTAGG - Intergenic
921457317 1:215387627-215387649 CTTTAAACCCTCATCAAACTAGG + Intergenic
921805576 1:219450509-219450531 CATTAAATTATAATGCAGCTAGG - Intergenic
921948502 1:220905547-220905569 CTTTATACTTTAGTGTAGCTTGG + Intergenic
922045000 1:221936929-221936951 CTTTAAACTATACTGATGCCTGG + Intergenic
1063605646 10:7520873-7520895 CTTTTAAATCTAATGAGGCGTGG + Intergenic
1065541396 10:26772579-26772601 CTTTAACCTCTTATGAAGTTCGG + Intronic
1065888340 10:30098520-30098542 CTGTAAACTCCAAGAAAGCTGGG + Intronic
1066345455 10:34580706-34580728 CTTGAAACTGTGATCAAGCTTGG + Intronic
1067271023 10:44791371-44791393 CTTTAAACTAAAATGTAGCCGGG - Intergenic
1072779183 10:98233570-98233592 GTTTAACCTCTCTTGAAGCTAGG - Intronic
1074535121 10:114323369-114323391 CTTTAAACTTTAAGCAAGTTGGG + Intronic
1074796387 10:116949745-116949767 CTTTGAACTCTGATGACTCTTGG + Intronic
1074883230 10:117674594-117674616 CTTGAAAATCTAATGAAGAATGG - Intergenic
1076153689 10:128186164-128186186 CTTTAGCCTCTAAAGAAGCCAGG - Intergenic
1078502718 11:11898694-11898716 CTTTAAACTCTAATGGTATTTGG - Intronic
1078642635 11:13110741-13110763 TTTTAAAGTCAAATGAAGTTGGG + Intergenic
1081232754 11:40606163-40606185 CTTGAAGCACTAATGAAGCTTGG + Intronic
1081255821 11:40893171-40893193 CTTTAAAAACTCATGAAGATAGG + Intronic
1081974123 11:47220565-47220587 CTTTACACTGTAATGAAGATTGG + Intronic
1084551971 11:69849659-69849681 CTTCAACCTCTCATGTAGCTGGG + Intergenic
1085152757 11:74265346-74265368 CTTCAGACTCTGAGGAAGCTGGG + Intronic
1086010689 11:82099438-82099460 ATTTACACTCTAATGAAGATTGG - Intergenic
1089095780 11:115918850-115918872 CTTTAAACTTAAATGTAACTTGG + Intergenic
1091022264 11:132110950-132110972 CCTTAGACTCTAAAGTAGCTGGG - Intronic
1092150770 12:6246870-6246892 CCTTAGACTCTAATGATGCCTGG - Intergenic
1093508501 12:19897902-19897924 ATTTAAACTCTACTGAATTTGGG + Intergenic
1093747342 12:22757219-22757241 CTTTAAAATCTCCTAAAGCTGGG + Intergenic
1095459636 12:42429441-42429463 GTTTAAACAGTAATGAATCTTGG - Intronic
1099453946 12:82841878-82841900 CTTTTAACACTAAGGAATCTTGG - Intronic
1099907976 12:88794294-88794316 TTTTAAAATGTAATGAAGCCAGG - Intergenic
1101239040 12:102819793-102819815 CTTTTAACCCAAATAAAGCTGGG - Intergenic
1101712332 12:107280064-107280086 TTTGAAATTCTAATTAAGCTGGG + Intergenic
1102017682 12:109658564-109658586 CTTTTGACTCTAATGAGGCCGGG + Intergenic
1103204965 12:119121491-119121513 ATTTGAACTCTCATGACGCTTGG - Intronic
1106014030 13:25851195-25851217 CATTAAACTTTAATGAAGATGGG - Intronic
1107794123 13:44032283-44032305 CTTTAAAGCCTAATGAGGCCAGG - Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108545023 13:51484425-51484447 CTAAAAACTCTAAATAAGCTAGG - Intergenic
1110716701 13:78713492-78713514 CTTTTGAGTCCAATGAAGCTGGG + Intergenic
1113418702 13:110152764-110152786 CTTTAAACTCTAATGAAGCTGGG - Intronic
1115991671 14:39156431-39156453 AAATAAAATCTAATGAAGCTGGG + Intronic
1116548984 14:46210043-46210065 CTTTACACTCCAATGAAACATGG - Intergenic
1117405304 14:55396507-55396529 CTGCAAACTCTAGAGAAGCTTGG + Intronic
1118826153 14:69383850-69383872 TTTTAAAGTCTAATGCAGCCGGG + Intronic
1120060052 14:79971649-79971671 CTTTAGCCTCAAATGAAGCTTGG + Intergenic
1120457465 14:84750713-84750735 CTTTAAACTTTAATGAAGAATGG - Intergenic
1120891157 14:89492364-89492386 CTTAAAACTCCACTGAAGTTGGG + Intronic
1122167759 14:99842312-99842334 CTTTACACTTCAATTAAGCTGGG - Intronic
1124813377 15:32964367-32964389 CATAAAACTCTAATAATGCTTGG + Intronic
1125073107 15:35579708-35579730 ATTTAAGCTGTCATGAAGCTGGG + Intergenic
1126761532 15:51974255-51974277 CTGTAAACTTTAATCAAACTGGG - Intronic
1127137693 15:55941893-55941915 CTTTTAACTGTACTGAAACTCGG + Intronic
1130513359 15:84607087-84607109 CTTCTAATTCTAATGAAGATCGG + Intronic
1133143995 16:3770163-3770185 CTTAAAACTCCATTGAGGCTGGG - Intronic
1133615059 16:7468678-7468700 CTTTAAAGTCTTCTGAAGATAGG + Intronic
1133911756 16:10072451-10072473 CTTTAAAAACTACTGAAGCTGGG + Intronic
1137821230 16:51447988-51448010 CTTTAAGGTCAAATGAACCTGGG + Intergenic
1140616462 16:76670580-76670602 GATGAAACTCTAAGGAAGCTGGG - Intergenic
1143580121 17:7820545-7820567 CTGAAAACTCTACTGCAGCTTGG + Intronic
1146267403 17:31461964-31461986 CTTTAAAAACTAATGTGGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150917760 17:69453865-69453887 CTTTAAAATATAATGATGCCTGG - Intronic
1151531604 17:74709679-74709701 CTGTAACCTCTTATGTAGCTGGG + Intronic
1153372836 18:4339087-4339109 CTTTAGACTCACATGAAACTGGG + Intronic
1153912251 18:9714569-9714591 CTTTAAAATTTAATTAAGCCTGG + Intronic
1156013277 18:32518490-32518512 TTTTAAACTCTAATTAAAGTGGG - Intergenic
1158760644 18:60381682-60381704 CTATAAAGTCTAAGGAAGGTTGG + Intergenic
1159183352 18:64939486-64939508 CTTTAAACACGAATGAGGCTGGG + Intergenic
1166683938 19:44784004-44784026 GTTTAAACTCCAGTGAAGCGAGG + Intronic
1166819602 19:45569553-45569575 TTCTAAACTCTAATGGAGGTGGG - Intronic
1167981553 19:53280453-53280475 CTTTAAAATCTCAGGAAGATGGG + Intergenic
1167984536 19:53303188-53303210 CTTTAAAATCTCAGGAAGATGGG - Intergenic
1168007172 19:53499831-53499853 TTTCAAAGTCAAATGAAGCTGGG + Intergenic
926044529 2:9699994-9700016 CTTTGGAGTCTGATGAAGCTAGG + Intergenic
927856900 2:26533471-26533493 CTTACAACTCTAAAGAAGCTGGG - Intronic
930611302 2:53547058-53547080 CTTTTGACTCTCAGGAAGCTTGG - Intronic
931013136 2:57942071-57942093 CTTTAAAATCTGCTGAAGCCAGG - Intronic
931322947 2:61189568-61189590 CTTTAAGAACTAATGAGGCTGGG - Exonic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
937570689 2:123355591-123355613 ATTTAAACTGGAAAGAAGCTGGG + Intergenic
941593239 2:167445951-167445973 CTGTAAAGTCTATTGATGCTAGG - Intergenic
942668737 2:178350918-178350940 CTTAAAACTCTGTTGATGCTTGG - Intronic
943008168 2:182412120-182412142 CTTTAAACTCTCACCAACCTAGG + Intronic
943662832 2:190577578-190577600 TTTTAAACCCTAGTGAAGCTGGG + Intergenic
945815832 2:214604070-214604092 CTTTAAAAGCTACTGATGCTGGG - Intergenic
1169055909 20:2620833-2620855 CTTTAAAACTTAATGGAGCTTGG + Intronic
1169148747 20:3272522-3272544 CTGAAAATCCTAATGAAGCTGGG - Intronic
1171079652 20:22165782-22165804 CCTTAAAGTCAAATGCAGCTTGG - Intergenic
1171153128 20:22845460-22845482 CATTAAACTCTAATTAGGTTAGG + Intergenic
1172928521 20:38563717-38563739 CTTTAAAATCTAAGGCAGTTTGG - Intronic
1173114894 20:40231744-40231766 CTTTAAATTCTAATGGAGGTGGG + Intergenic
1173284343 20:41656526-41656548 CTTCAGACTCTAAGCAAGCTTGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1177734250 21:25069258-25069280 CTTAAATCTATGATGAAGCTTGG + Intergenic
952913163 3:38208410-38208432 GTATAAACTCTAAGGAATCTTGG - Intronic
953058151 3:39404830-39404852 CTTTAAAAGCTACTGATGCTTGG + Intergenic
954974159 3:54677002-54677024 CTTTAAACTCAAATGATGTGTGG + Intronic
955688340 3:61566083-61566105 CTTAAAACACTAATAAAGATAGG + Intronic
956109812 3:65859426-65859448 CTTAAAACTTTAAGGAAGCAGGG + Intronic
958066501 3:88550714-88550736 CTTTAATCTCTAGTAAGGCTGGG + Intergenic
958985257 3:100773170-100773192 CTTCTAATTTTAATGAAGCTCGG - Intronic
959784879 3:110284052-110284074 TTTTTAATTCTAAAGAAGCTTGG - Intergenic
960006520 3:112786855-112786877 CTTTAAAAACTACTGAAGCCTGG + Intronic
960894959 3:122493878-122493900 GTTAAAACTATAATGAGGCTGGG - Intronic
961971137 3:130970014-130970036 CTTTAAAAAATATTGAAGCTTGG + Intronic
962815825 3:138998210-138998232 TTTAAAACTCTAAGGAAACTAGG - Intergenic
964400654 3:156294465-156294487 CTTTTAACCCTAAGAAAGCTTGG - Intronic
965337856 3:167449786-167449808 TTTGAAAATCTAATGATGCTGGG - Intronic
965939254 3:174157647-174157669 CTTTAAACTCTAATGATGCTGGG + Intronic
967080472 3:186045000-186045022 ATCTAAATTCTAATGCAGCTGGG - Intergenic
971090781 4:23342851-23342873 TTTTAAAGTCTAATAAAGCAAGG - Intergenic
973060390 4:45717034-45717056 GCTTAAACTATAATGAAGGTGGG - Intergenic
974272538 4:59669695-59669717 CTTTGAACTCTGAAGTAGCTTGG + Intergenic
976811197 4:89103156-89103178 CTTTAAACCCAAATGTAACTGGG + Intronic
977390644 4:96405335-96405357 TTGTAAATTCTAATGAAGGTTGG - Intergenic
979336728 4:119472042-119472064 CATTACAATCTATTGAAGCTGGG - Intergenic
979680302 4:123452055-123452077 CTTTAAAGTCTAGTGATGTTTGG + Intergenic
980570100 4:134604160-134604182 TTTTAAACTCAAATAAAGATAGG + Intergenic
981504462 4:145483453-145483475 CTTTAAATTGTATTGAAGGTAGG + Intronic
981599173 4:146466415-146466437 TTTTAAACTGCAAAGAAGCTTGG - Intronic
982056891 4:151560015-151560037 TTTTAAACTTTATTGAAGCGGGG + Intronic
983880869 4:172930974-172930996 TTTTAAACTTTTATGAATCTAGG + Intronic
984186242 4:176547054-176547076 CTTTAAACTACAAGGCAGCTGGG - Intergenic
984715694 4:182922794-182922816 CTTTCTACTCTAATGAATCCTGG - Intergenic
989102065 5:37832851-37832873 CTTTAAAGACTACTGATGCTAGG - Intronic
989509559 5:42269165-42269187 CTTTAAACACCAATGAGGCTGGG + Intergenic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
993300413 5:86202330-86202352 CTTTAATCTGTAATGAACATGGG + Intergenic
993624444 5:90207973-90207995 CTTTAAAATATATTGAATCTTGG - Intergenic
994163854 5:96587009-96587031 CTTTAAACTTGAATAAATCTCGG - Intronic
995130612 5:108626601-108626623 ATTTTAACCCTAAAGAAGCTTGG + Intergenic
995942071 5:117598939-117598961 CTTTGAACTCCAATGCATCTAGG - Intergenic
996048092 5:118898695-118898717 TTTTAAAATCTAATAAAGCTTGG + Intronic
999544238 5:152609169-152609191 CTTTAAAGTCATATGTAGCTGGG + Intergenic
1000109788 5:158097383-158097405 TTGTAAACTCTCATTAAGCTAGG - Intergenic
1000198408 5:158983534-158983556 CTTCAAACACTATTGAAGGTAGG - Intronic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1003340912 6:5219995-5220017 CTTTCCACTCTCCTGAAGCTTGG + Intronic
1003761157 6:9180439-9180461 ATAAAAACTCCAATGAAGCTTGG + Intergenic
1004421584 6:15475293-15475315 CTTGCAAATCTAATGAAGCTTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622824 6:27635670-27635692 TTGTAAACTCTGATGAAGCCGGG - Intergenic
1007383735 6:41506608-41506630 CTTAAAACTCAAGTGAAGCTTGG - Intergenic
1009320533 6:62282912-62282934 CTTTAACCTCAACTGAATCTGGG - Intronic
1009652425 6:66492986-66493008 CTATAAACTCTCAATAAGCTAGG + Intergenic
1009739466 6:67724688-67724710 TTTTATACACTATTGAAGCTAGG - Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013542497 6:111124223-111124245 CTTTCAACTCTTGTGAAGTTAGG + Intronic
1016700737 6:147051220-147051242 CTTTAAAAAGTAAAGAAGCTAGG - Intergenic
1017522762 6:155216398-155216420 CTTGAAAATCAAATGAAGCCTGG + Intronic
1020836002 7:13151887-13151909 CTTTGAAATCAAATGAAACTTGG - Intergenic
1021649318 7:22818210-22818232 TTTCATACTCTAATGAAGATTGG - Intronic
1022855670 7:34311110-34311132 CTTTAAACGCTAGTGAATCTTGG - Intergenic
1023064333 7:36361593-36361615 CTAAAAACTCAAAAGAAGCTAGG + Intronic
1024355162 7:48407045-48407067 AATTATACTTTAATGAAGCTGGG - Intronic
1025833336 7:65073925-65073947 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1025903099 7:65763426-65763448 CTTGAAACTCATTTGAAGCTTGG - Intergenic
1026668512 7:72365543-72365565 CCTTAAACTCCTATGTAGCTGGG + Intronic
1027109733 7:75427807-75427829 TTTTGAACTCTTATTAAGCTTGG - Intronic
1030218551 7:107073409-107073431 CTATAAACTCTTAAGATGCTAGG - Intronic
1031135634 7:117880816-117880838 CTTTAAGGTCAAATGAAGATTGG + Intergenic
1034508581 7:151517066-151517088 CTTTAAAATCAAATGCGGCTGGG + Intronic
1036719000 8:11155020-11155042 TTTTAATCTCTAACGCAGCTCGG - Intronic
1039250405 8:35657916-35657938 ATTTAAATTTAAATGAAGCTTGG + Intronic
1040861529 8:52004365-52004387 CTTTAAACTCTAAAGAACATGGG - Intergenic
1041312263 8:56529371-56529393 CTTTAAATGATACTGAAGCTGGG + Intergenic
1041949152 8:63480641-63480663 TTTTAATCTCTAAAGGAGCTTGG - Intergenic
1042141186 8:65680277-65680299 CTTTAGACTCTCCTGTAGCTAGG + Intronic
1044855594 8:96472177-96472199 TTTTTAGCTCTAATGAACCTAGG - Intergenic
1046968989 8:120199718-120199740 ATTTTAACTGTAAGGAAGCTGGG - Intronic
1054830120 9:69615581-69615603 ATTTAAAATCTATTGAGGCTAGG - Intronic
1054944105 9:70776301-70776323 CTGTAAAGTCGAAGGAAGCTGGG + Intronic
1056458414 9:86785660-86785682 TTTCAAACTCTAATAAATCTGGG - Intergenic
1061379666 9:130246780-130246802 CTTTTTATTCCAATGAAGCTTGG + Intergenic
1062246936 9:135573928-135573950 TTTAAAACACTAATGAAGTTGGG + Intergenic
1186273489 X:7915704-7915726 ATTTAATCCCTAAGGAAGCTAGG - Intronic
1189237741 X:39501156-39501178 CTGTAGACTCTAAGGAACCTCGG - Intergenic
1190376296 X:49791680-49791702 CTTTAAACGCTGAGGAATCTGGG + Intergenic
1190886834 X:54537857-54537879 CCTTAACCTCTCATGTAGCTGGG + Intronic
1191168482 X:57417802-57417824 CTTTTAAGTCTGCTGAAGCTGGG + Intronic
1192191133 X:68991809-68991831 CTTTAAACTGTAATCAAGGTGGG + Intergenic
1194102386 X:89722035-89722057 ATTTATACTCTAATAAAGTTGGG - Intergenic
1195898016 X:109768555-109768577 TATTGAACTCTGATGAAGCTGGG + Intergenic
1196200803 X:112883844-112883866 CTCAAAACTCTAAGGAAACTTGG - Intergenic
1198503984 X:137282609-137282631 CTTTAAACTCTGAAAAAGCAAGG + Intergenic
1199469770 X:148181613-148181635 CTTTTAAGTCTGCTGAAGCTGGG + Intergenic