ID: 1113419326

View in Genome Browser
Species Human (GRCh38)
Location 13:110158102-110158124
Sequence GTCTCAAAACAGTCAATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113419325_1113419326 13 Left 1113419325 13:110158066-110158088 CCTTCTAGTTATCAGGCATGGTT 0: 1
1: 0
2: 1
3: 7
4: 123
Right 1113419326 13:110158102-110158124 GTCTCAAAACAGTCAATATCTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113419326 Original CRISPR GTCTCAAAACAGTCAATATC TGG Intronic
900860825 1:5228694-5228716 GTCTCAAAACAGCAAAAATTAGG - Intergenic
901008583 1:6184205-6184227 GTCTTAAGACAGTTGATATCTGG - Intronic
906549224 1:46648409-46648431 GTCTCAAAACAATAAAAATAGGG - Intronic
908901278 1:68959228-68959250 GTCTGAAAAGAGTCAAAAACTGG - Intergenic
909071379 1:70997835-70997857 GTCTCAAAACAGTCATACTATGG - Intronic
912175177 1:107146166-107146188 AACTCAAAACAGTCAATTCCGGG + Intronic
912631943 1:111253963-111253985 GTCTCAAAACAGCTAATAAGAGG - Intergenic
915910385 1:159911380-159911402 GTCTCAGAACAGACAGTGTCAGG - Intergenic
921761362 1:218918930-218918952 GTCTTAAGAAAGTCAACATCTGG - Intergenic
923435001 1:233959824-233959846 GTCTCAAAAATCTCAATGTCTGG + Intronic
923805310 1:237251181-237251203 GAGTCAAAAAAGTAAATATCTGG - Intronic
1063810787 10:9704525-9704547 GTCACAAATCAGTAAATATCAGG + Intergenic
1068655532 10:59571323-59571345 TTCTCATGACATTCAATATCAGG + Intergenic
1068765804 10:60762378-60762400 TTTTCAAAACACTCAACATCAGG + Intergenic
1069871504 10:71535906-71535928 TTACCAAAACAGACAATATCAGG + Intronic
1072061416 10:91815074-91815096 GTCTCACAAAAGTAAATACCAGG - Intronic
1074309632 10:112311195-112311217 GTCTCCAAATAGACAGTATCTGG + Intergenic
1075757261 10:124822954-124822976 GTCTCAAAACAGTTAAAAGTTGG + Intronic
1079639122 11:22782129-22782151 GTGACAAAACAGTCAGTACCAGG - Intronic
1079802191 11:24883593-24883615 TTCTCACTACAGTCAATATTTGG + Intronic
1081487355 11:43541920-43541942 GGCTCAAAGCCGTCAACATCAGG - Intergenic
1086408975 11:86524945-86524967 ATCTCAGAACATTCAAGATCAGG + Intronic
1087310580 11:96537486-96537508 CTCTCAAAATAATCAAGATCTGG - Intergenic
1090506915 11:127325222-127325244 TTCTCAAAACACTGAACATCAGG + Intergenic
1092070118 12:5625260-5625282 GGCACAAACCAGTCAATATGAGG + Intronic
1092549540 12:9483338-9483360 CTCTCACAACAGTCACTAACTGG - Intergenic
1095388656 12:41679122-41679144 GTTTCAATAAAGTCACTATCTGG - Intergenic
1102696009 12:114799976-114799998 TTCTCAAAACAGTGAAGAACAGG + Intergenic
1102724813 12:115052232-115052254 GTCTGAAAACAGTTAATAAAAGG + Intergenic
1103157539 12:118698999-118699021 ATCTCAGAACAGTCAAGAACAGG - Intergenic
1105710459 13:23003175-23003197 GTCTAAAGACAGTCAAAATGAGG + Intergenic
1106997341 13:35501703-35501725 TTCTTAAAACAGTTAATATATGG + Intronic
1109581190 13:64338119-64338141 GTTTCAACACTGTCAATTTCAGG - Intergenic
1111422188 13:88026938-88026960 GTCTCAAAGCATACAATTTCAGG - Intergenic
1113419326 13:110158102-110158124 GTCTCAAAACAGTCAATATCTGG + Intronic
1114227049 14:20748303-20748325 GTATAAAGAGAGTCAATATCAGG - Exonic
1114229840 14:20770875-20770897 GTATCAAGAGAGTCAATATCAGG - Exonic
1119003137 14:70901112-70901134 CTCTCAAATCAGTAAAGATCAGG - Intergenic
1119083458 14:71718682-71718704 GTCCCAAAACAGACAAAATAAGG - Intronic
1125762482 15:42106148-42106170 GTCTCAAAAAAGCGAGTATCTGG + Intergenic
1126705355 15:51400726-51400748 GTCCTAAAACAGGCGATATCTGG - Intronic
1127101209 15:55566731-55566753 GTCTCAAAACCATCAAAACCAGG - Intronic
1130675358 15:85947371-85947393 GTCTACAAACAGTCAAAATTAGG - Intergenic
1132543958 16:524586-524608 GACTCAGAACATTCAATGTCAGG - Intergenic
1132954491 16:2584367-2584389 GTCTCAAAACAAACAAAATCTGG - Intronic
1132959854 16:2615796-2615818 GTCTCAAAACAAACAAAATCTGG + Intergenic
1138824754 16:60305490-60305512 CTCTTAAAATATTCAATATCAGG - Intergenic
1139783796 16:69373828-69373850 GTCTCAAAACAAACAATAAAAGG + Intronic
1150434789 17:65145389-65145411 GTCTCAAAAAAGTAAAAATAAGG - Intronic
1150655424 17:67036055-67036077 GTCTTAAAACAGCAAATACCAGG + Intergenic
1163789093 19:19295706-19295728 GTCTCAAAACAAACAAAAACTGG + Intronic
1167076776 19:47255090-47255112 GTCTCAAAAAAATAAATAACTGG - Intergenic
926521157 2:13915826-13915848 GTCTCATGTCAGTAAATATCAGG + Intergenic
928521539 2:32093988-32094010 CTCTCAAACCAGTCAGTATTAGG + Intronic
928841420 2:35609802-35609824 GTCTCAAAAAAGACCATTTCAGG + Intergenic
930505033 2:52272812-52272834 GTCTCATAACAGTCCAAATTTGG - Intergenic
931930239 2:67124723-67124745 GTCTCAAAACACAAAACATCTGG - Intergenic
934321712 2:91976898-91976920 GTCTCAAAAAAGTAAAAATAAGG - Intergenic
935447260 2:103169761-103169783 GAGTCAAATCATTCAATATCAGG + Intergenic
938750010 2:134319391-134319413 GTATAAAGAGAGTCAATATCAGG + Intronic
942900832 2:181116139-181116161 GTCTCATAACAGGGAATAACAGG - Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1170352167 20:15453708-15453730 GTCTGAAAACAGTCCTTCTCTGG + Intronic
1170505361 20:17020272-17020294 GTCTCATAACAGACACTATCTGG - Intergenic
1173181584 20:40810202-40810224 GTCTCAAAAAAGGCAAGATGAGG + Intergenic
1174471163 20:50762061-50762083 ATCTCAAATCAGTCATTCTCAGG + Intergenic
1175577416 20:60071171-60071193 GTCTCAAAACAGACAACACCTGG - Exonic
1175830135 20:61959881-61959903 GTCTGAAAACACACAATATATGG - Intronic
1179799970 21:43806925-43806947 GTCTCAAACCAGGAAAAATCAGG + Intergenic
1180154174 21:45970208-45970230 GTCTCAAAAACGTCAAGGTCAGG + Intergenic
1184354109 22:43967061-43967083 GTCTCATCACAGTCATTCTCAGG + Intronic
1184547724 22:45183113-45183135 TTCTCAAGTCAGTCAAAATCAGG - Intronic
949796547 3:7857698-7857720 AACTTAAAACTGTCAATATCAGG - Intergenic
953634816 3:44653877-44653899 GGTTCAAAATATTCAATATCTGG - Intronic
957145310 3:76415218-76415240 GCCTCAGAACTGTCAATATGGGG - Intronic
958548119 3:95582590-95582612 GTCCCCACACAGTCAAAATCTGG + Intergenic
959388819 3:105747341-105747363 GTCTCAAAACAAACAAAAGCAGG - Intronic
960721955 3:120633196-120633218 TTCTCAAAGCAGTCAGCATCAGG + Exonic
960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG + Intronic
962105799 3:132387701-132387723 GTATCAACAAAGCCAATATCTGG + Intergenic
963479884 3:145858795-145858817 GTCTCAAAGCAGGCAATTTGAGG + Intergenic
967324227 3:188223176-188223198 GTGTCAAAACCATCAATTTCTGG + Intronic
967384075 3:188893545-188893567 ATATCAAAACAGTCAAAATTTGG + Intergenic
975196627 4:71532506-71532528 GTCTCAAAAAAGAAAAAATCAGG - Intronic
975268000 4:72393958-72393980 CTGTCTAAACAGTCTATATCTGG + Intronic
978549058 4:109904668-109904690 GTCTCAAAACAGAAAAGATAAGG - Intergenic
979388133 4:120094089-120094111 CACTCAAAACAATAAATATCAGG - Intergenic
979725416 4:123955438-123955460 GAATCAAAACAGTGAATAGCTGG + Intergenic
980748241 4:137050933-137050955 TTCTCAACACAGTCACTTTCTGG + Intergenic
981205352 4:142034081-142034103 GTCTCAGCACTGTCAATATTCGG - Intronic
987095773 5:14548125-14548147 ATCTCAAAAAAGTCACTTTCTGG + Intergenic
987389858 5:17365766-17365788 GTCTCTAAACATTCATTAGCTGG + Intergenic
988502748 5:31797241-31797263 ATATAAAAACAGTAAATATCAGG - Intronic
989118250 5:37977651-37977673 GACTCAAATCAGTCTCTATCAGG + Intergenic
991630389 5:68650659-68650681 GCCTCAAAACAGACTATATCTGG + Intergenic
991930896 5:71751625-71751647 GTGTCAGCACAGTCAATTTCTGG + Intergenic
993125232 5:83826356-83826378 GACTCAAAACAGGCAAGGTCAGG + Intergenic
1004790365 6:19019355-19019377 GTCTCAATAAAGAAAATATCAGG + Intergenic
1009035940 6:58117333-58117355 GTGACAGAACAGTCAACATCAGG + Intergenic
1009211762 6:60870934-60870956 GTGACAGAACAGTCAACATCAGG + Intergenic
1010617068 6:78026257-78026279 CTCTCCAAATAGTCAATTTCAGG + Intergenic
1011545123 6:88475069-88475091 CTCTCAAAGCAGACAAAATCTGG + Intergenic
1014462575 6:121714783-121714805 GTCTGGAAAAAGTCATTATCTGG - Intergenic
1019709628 7:2512248-2512270 GTCTCCAAACATTCACTGTCAGG + Intergenic
1023540986 7:41265571-41265593 CTCTCAACAATGTCAATATCAGG + Intergenic
1027622473 7:80506541-80506563 TTCTGAAAACTGTAAATATCGGG + Intronic
1028617295 7:92782849-92782871 GACTTAAAAATGTCAATATCTGG + Intronic
1034418489 7:150977401-150977423 GGCACAACACAGTCAAGATCTGG + Intronic
1036028996 8:4944907-4944929 TACTCAAAACAGTCGACATCAGG + Intronic
1046254383 8:111677093-111677115 GTATCAAACCAGGCAAAATCTGG - Intergenic
1046717617 8:117584894-117584916 GTCACACAGCAGTCAAAATCAGG + Intergenic
1046751979 8:117935785-117935807 GTCTCAACACAGACAATCACAGG + Intronic
1048942378 8:139412723-139412745 GTCTCACCACAGCCAATTTCAGG - Intergenic
1053160200 9:35808791-35808813 GTCTCCAAAAAGACAATAACGGG - Exonic
1054920061 9:70534254-70534276 GTCTGAAATCACTCACTATCAGG - Exonic
1060009893 9:120034333-120034355 GTCTCAAAAAAGAGAATATGTGG + Intergenic
1060360776 9:122954723-122954745 GTCCCAAAACACTCAGTATTGGG - Intronic
1186737284 X:12478930-12478952 TTCTCAAAACTTTCAATATGTGG - Intronic
1188828963 X:34872798-34872820 GTCTCAAAATAACCAATAACTGG + Intergenic
1189597698 X:42587155-42587177 ATGTCAAAGCAGTCAATCTCTGG + Intergenic
1189630897 X:42952226-42952248 GTCTTAGAACAGTCAATTTCAGG + Intergenic
1195366648 X:104132958-104132980 GTCTCCAAACAGTCTGTATAAGG + Intronic
1195861192 X:109385224-109385246 GTCTCCAAACAAGCAGTATCTGG + Exonic
1197358762 X:125471341-125471363 TCTTCAAAACAGTCAATGTCAGG + Intergenic
1198305949 X:135383233-135383255 GTGTTAAAAAAGTCAAAATCAGG + Intergenic