ID: 1113420425

View in Genome Browser
Species Human (GRCh38)
Location 13:110167157-110167179
Sequence CCAGGAGTTCCAGGATTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113420425_1113420434 13 Left 1113420425 13:110167157-110167179 CCTTGAAATCCTGGAACTCCTGG 0: 1
1: 0
2: 3
3: 43
4: 306
Right 1113420434 13:110167193-110167215 CCCTTAGAGCCTGTGATTCCTGG 0: 1
1: 0
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113420425 Original CRISPR CCAGGAGTTCCAGGATTTCA AGG (reversed) Exonic