ID: 1113420653

View in Genome Browser
Species Human (GRCh38)
Location 13:110169430-110169452
Sequence CCAGTAACCCACATCTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113420653_1113420657 9 Left 1113420653 13:110169430-110169452 CCAATAAAGATGTGGGTTACTGG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1113420657 13:110169462-110169484 AAGAAAGAACTGATTTAGTGGGG 0: 1
1: 0
2: 2
3: 27
4: 357
1113420653_1113420656 8 Left 1113420653 13:110169430-110169452 CCAATAAAGATGTGGGTTACTGG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1113420656 13:110169461-110169483 AAAGAAAGAACTGATTTAGTGGG 0: 1
1: 0
2: 1
3: 55
4: 571
1113420653_1113420655 7 Left 1113420653 13:110169430-110169452 CCAATAAAGATGTGGGTTACTGG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1113420655 13:110169460-110169482 GAAAGAAAGAACTGATTTAGTGG 0: 1
1: 0
2: 5
3: 55
4: 543
1113420653_1113420659 16 Left 1113420653 13:110169430-110169452 CCAATAAAGATGTGGGTTACTGG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1113420659 13:110169469-110169491 AACTGATTTAGTGGGGATGTGGG 0: 1
1: 0
2: 0
3: 18
4: 160
1113420653_1113420658 15 Left 1113420653 13:110169430-110169452 CCAATAAAGATGTGGGTTACTGG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1113420658 13:110169468-110169490 GAACTGATTTAGTGGGGATGTGG 0: 1
1: 0
2: 0
3: 13
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113420653 Original CRISPR CCAGTAACCCACATCTTTAT TGG (reversed) Intronic
902454801 1:16525086-16525108 CCAGCAACCCACAAATTTATGGG - Intergenic
902497647 1:16885267-16885289 CCAGTAACCCAGATATTTATGGG + Intronic
902689153 1:18098965-18098987 CGAATAACACACATGTTTATTGG - Intergenic
904752110 1:32747471-32747493 CCATTAAACCCCATCTTTGTCGG - Intronic
909071229 1:70996187-70996209 CCAGACACTCACATCTTTGTTGG - Intronic
909944435 1:81648005-81648027 CTAGTGACCCACATCTAAATAGG - Intronic
911022195 1:93400274-93400296 TCAATAACCCACAAATTTATAGG + Intergenic
913105146 1:115607467-115607489 CTCTTAACCCACATCTATATTGG + Intergenic
913480474 1:119283968-119283990 CCAGAGACACAGATCTTTATTGG - Intergenic
917542092 1:175923968-175923990 CCACTATCCCACATATTTGTGGG - Intergenic
918788326 1:188793533-188793555 CCAGAAAAGCACCTCTTTATGGG + Intergenic
921418155 1:214914617-214914639 TCATTGACCCACTTCTTTATTGG - Intergenic
923174576 1:231451911-231451933 TCCGTAGCCCACTTCTTTATTGG - Intergenic
924615414 1:245608093-245608115 CCACCAACCCACATCCTCATGGG - Intronic
1065599448 10:27354048-27354070 CCAGTAACCCACAAATTACTGGG + Intergenic
1066417840 10:35237790-35237812 CTAGTATCCCACACATTTATGGG + Intergenic
1068834523 10:61539288-61539310 CCAGTCAGCCACCTCTTTTTAGG - Intergenic
1069004905 10:63306461-63306483 CCAGTAACCCACAATTTTGAAGG + Intronic
1071112157 10:82172369-82172391 GCAGTAACCCACATATTCTTGGG - Intronic
1074010623 10:109475229-109475251 CCAGTTACCCAACTCTTTCTTGG + Intergenic
1079495607 11:21039850-21039872 CTATTAACCCACACCTTTCTTGG + Intronic
1080612180 11:33914327-33914349 CCAGTTATCTTCATCTTTATGGG - Intergenic
1081368254 11:42263875-42263897 CCACTAAGACACATGTTTATTGG - Intergenic
1083527348 11:63381554-63381576 CAAGTAACTCAGTTCTTTATGGG + Intronic
1085881615 11:80473916-80473938 CCAGTAACCTACATCCTTTTAGG - Intergenic
1089791714 11:120950017-120950039 CCAGTAACTCACATGTCTTTTGG + Intronic
1091551711 12:1540091-1540113 CCAGGAACCCACCTCTTGGTTGG - Intronic
1096898982 12:54854697-54854719 CCATAAGCCCACATCTTTAGAGG - Intronic
1100781459 12:98031282-98031304 TCAGTAACCCACATGTGTCTAGG - Intergenic
1103370039 12:120412288-120412310 CCAGTAACATACATATATATAGG + Intergenic
1103379289 12:120481401-120481423 CCAGCTACCCACATTTTTGTTGG + Intronic
1104879379 12:132059674-132059696 CCAATATCGCACATCTTTACAGG - Intronic
1108799689 13:54080490-54080512 CAAGTAACCCACATTTTCATTGG + Intergenic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1115302509 14:31900529-31900551 CCAGAAATCCACATTCTTATAGG - Intergenic
1116773597 14:49154346-49154368 TCAGCTACCCACATCTTTGTAGG - Intergenic
1120399838 14:84016807-84016829 CCAATAACCCAGATCTTTTGTGG - Intergenic
1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG + Intergenic
1125397789 15:39269250-39269272 CCAGAAACCCAGATTTTTACAGG + Intergenic
1127257071 15:57301510-57301532 CCAGTACCCCACATGTTTTAGGG - Intergenic
1128117959 15:65124059-65124081 CCACCAACCCACATCTCTCTCGG + Intronic
1130842338 15:87712704-87712726 TCAGAAAACCACATTTTTATTGG - Intergenic
1136924608 16:34360343-34360365 CCTGTAAACAATATCTTTATAGG - Intergenic
1136979965 16:35051463-35051485 CCTGTAAACAATATCTTTATAGG + Intergenic
1139763258 16:69204800-69204822 CCAGTTTGCCACATCTTTCTTGG + Intronic
1140297770 16:73725886-73725908 CCACTAAGCCACAGCATTATGGG + Intergenic
1140524283 16:75609512-75609534 CAAAAAACCAACATCTTTATAGG + Intronic
1151033486 17:70770814-70770836 TCTGTAAACCACATCCTTATGGG - Intergenic
1153504963 18:5787657-5787679 TCAGTAACCCACAAATTTATGGG + Intergenic
1158982907 18:62782435-62782457 ACAGTAAGTCACATCTTTTTAGG - Intronic
1160792914 19:930969-930991 CCAGGAACCCGCATCTTCCTGGG + Intronic
925484813 2:4316363-4316385 CCAGCAACCCCCATCATCATGGG - Intergenic
925538029 2:4937222-4937244 CCAGTAATCAATGTCTTTATTGG - Intergenic
925846953 2:8043218-8043240 CCAATAAACCATATATTTATTGG + Intergenic
929204015 2:39269414-39269436 GCTGTAACCTACCTCTTTATTGG - Intronic
930991472 2:57661362-57661384 CCAGTAAGCAGCATCTTTAAAGG + Intergenic
931451792 2:62373675-62373697 CCAGAAATCCAGATTTTTATGGG + Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
931537882 2:63298954-63298976 CCAGTAAGCCACATCTTTTGTGG + Intronic
932940339 2:76157410-76157432 CAAGTAACCCATATGTTCATAGG - Intergenic
937157227 2:119729890-119729912 CCAGTGGCCCACATCTCTGTTGG + Intergenic
942619341 2:177830809-177830831 CAAGAAACCCTCATGTTTATGGG - Intronic
942636671 2:178014921-178014943 CCCATACCCCACATCTTTTTGGG - Intronic
945533017 2:210979602-210979624 CCCTTCACCCACATTTTTATGGG + Intergenic
946654822 2:221935472-221935494 CCAATAAAGCACCTCTTTATTGG - Intergenic
1170295080 20:14815198-14815220 CCAGGAAACCACATCTTTCTAGG - Intronic
1171017160 20:21552513-21552535 GAAGTCACCCACACCTTTATAGG - Intergenic
1172038488 20:32027167-32027189 CCAGTAACCCAGGACTTTCTTGG - Intronic
1173169377 20:40711367-40711389 CGAGAAGCCCACCTCTTTATGGG + Intergenic
1175012672 20:55755354-55755376 CTAGTAACCCACATATTCATTGG + Intergenic
949771155 3:7579679-7579701 CCACTTACCCACATATTTTTTGG + Intronic
950049155 3:9973122-9973144 CCAGAAATCCTCATCTTTAAGGG + Intronic
950839790 3:15956667-15956689 CCAGTTACCCTGATCTCTATTGG - Intergenic
952324691 3:32310421-32310443 CCAGTAAATAACATCTTAATGGG + Intronic
956655704 3:71548147-71548169 CCAGTCACCCACATTTTCAAAGG - Intronic
957113777 3:75997880-75997902 CCAGTAACCAATATCTGTAATGG + Intronic
958822372 3:98990283-98990305 CAAATAACCCACCTCTTTCTCGG - Intergenic
960386185 3:117024660-117024682 GCATTAAAGCACATCTTTATGGG + Intronic
971050796 4:22860111-22860133 CCAGAAACACAAATCTTTAAGGG + Intergenic
971266807 4:25103045-25103067 CCAGTGACCCAGATCTCTAGGGG - Intergenic
972305858 4:37828903-37828925 CAAGTAAACCCCATCTTTTTTGG - Intronic
972335399 4:38103428-38103450 CCAGTAACTCAAATATTGATAGG + Intronic
972463825 4:39332791-39332813 CCAGTAACCTAAATGTTGATTGG - Intronic
972978077 4:44662096-44662118 GCAGTACCCCTCATCCTTATGGG + Intronic
976740966 4:88357234-88357256 ACAGTAACCCACAAATTTGTGGG + Intergenic
978487030 4:109266526-109266548 CCAGCCCCCCATATCTTTATAGG - Intronic
979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG + Intergenic
980757335 4:137182541-137182563 TCACTAACCCAAATTTTTATTGG + Intergenic
984881284 4:184411952-184411974 CAAGTAACCCATAGCTTTCTTGG + Intronic
987467747 5:18292517-18292539 CCAGTCACCCTCTTCTTTATTGG + Intergenic
987653665 5:20777001-20777023 CCAGTCACACACCTCTTTCTAGG + Intergenic
988741912 5:34084492-34084514 CCAGTCACACACCTCTTTCTAGG - Intronic
992382154 5:76248499-76248521 CCAGTACCTCAGATCTATATTGG - Intronic
994476319 5:100275125-100275147 TTAGTAACTCACATCTTTACTGG - Intergenic
995421265 5:111969825-111969847 CCAGTGACCCTCAGCTTTCTGGG - Intronic
995461410 5:112407198-112407220 GCAGTAGCCCACACATTTATTGG + Intronic
996475361 5:123913182-123913204 CTAGTAACAAACATATTTATTGG + Intergenic
999062651 5:148653113-148653135 ACAGTCACCCACAGCTTTAAGGG + Intronic
1002906622 6:1454286-1454308 CCAATAGCCCACAAATTTATGGG - Intergenic
1006273113 6:32979681-32979703 CCAGTAGCCCACCTCTTACTTGG + Intronic
1007920378 6:45603949-45603971 CCAGTAATCCCCATGTTCATGGG - Intronic
1011581827 6:88876695-88876717 CCAGTAGCCCAGCTCTATATAGG + Intronic
1017132773 6:151122270-151122292 ACATCAACCCACATCTTTGTGGG + Intergenic
1017255511 6:152328933-152328955 CCAATAAGCCACATTTTTGTGGG - Intronic
1017338175 6:153286358-153286380 CCAATAACTCACATCTATATTGG + Intergenic
1018039414 6:159908887-159908909 CAAATAACCCACCTCTTCATGGG - Exonic
1020045749 7:5039118-5039140 CCAGGAACCCACAGGTTTTTCGG - Intronic
1020291155 7:6723323-6723345 CCAGGAACCCACAGGTTTTTCGG - Intergenic
1020467859 7:8501422-8501444 CCAGGAATCCACATTTTTAAAGG - Intronic
1027858358 7:83541986-83542008 ACAGTCAGCCACATCCTTATAGG + Intronic
1030728924 7:112961199-112961221 ACAGAAAGCCACATTTTTATTGG - Intergenic
1031385833 7:121149879-121149901 CCTGATGCCCACATCTTTATGGG + Intronic
1033214075 7:139481622-139481644 CCAGAAAGCCACATCTTGAAAGG - Intronic
1037171211 8:15894579-15894601 CCAGTAAGCCAGGTCTTTATCGG - Intergenic
1039142972 8:34413872-34413894 CCAGATATACACATCTTTATGGG + Intergenic
1042082643 8:65071768-65071790 CCAGCAACCCACATCACCATGGG - Intergenic
1047112613 8:121807592-121807614 CCACTAAACCTCATCTTCATTGG - Intergenic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1055212050 9:73807995-73808017 CCATTAACCAACAAATTTATTGG - Intergenic
1056025920 9:82495530-82495552 CCAGGAAGCCACATCCCTATGGG - Intergenic
1057680123 9:97172787-97172809 TCAGAAACTCACAACTTTATAGG - Intergenic
1059858106 9:118424235-118424257 TAAGTAATCCAGATCTTTATAGG + Intergenic
1187190493 X:17030487-17030509 CTAGCAGCCCACATCTTTATGGG - Intronic
1189631098 X:42954093-42954115 CCAGTATCCCACAAATTTGTGGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic