ID: 1113422941

View in Genome Browser
Species Human (GRCh38)
Location 13:110184059-110184081
Sequence GCTGTTGGTGACACACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113422937_1113422941 -8 Left 1113422937 13:110184044-110184066 CCCTAGGAAATGCCTGCTGTTGG 0: 1
1: 0
2: 3
3: 15
4: 174
Right 1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG 0: 1
1: 0
2: 3
3: 23
4: 143
1113422936_1113422941 4 Left 1113422936 13:110184032-110184054 CCAACTGAACGACCCTAGGAAAT 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG 0: 1
1: 0
2: 3
3: 23
4: 143
1113422939_1113422941 -9 Left 1113422939 13:110184045-110184067 CCTAGGAAATGCCTGCTGTTGGT 0: 1
1: 0
2: 0
3: 39
4: 189
Right 1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG 0: 1
1: 0
2: 3
3: 23
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113422941 Original CRISPR GCTGTTGGTGACACACACCC TGG Intronic
903071117 1:20727375-20727397 GCTGGTCAGGACACACACCCAGG - Intronic
904091697 1:27949478-27949500 GCTGTGTGTGAGACTCACCCAGG - Intronic
906668329 1:47637412-47637434 CCTGTGGGTGATACAGACCCAGG - Intergenic
907077902 1:51594918-51594940 GCTGCTGGTGACCTGCACCCTGG - Intronic
909982100 1:82115461-82115483 GCCCTTGGTGACACTCACCCTGG - Intergenic
911717241 1:101147208-101147230 GCTGATGGTGACACATATCTGGG + Intergenic
912848526 1:113100674-113100696 GGTCTTGGTGCCACACACTCTGG - Intronic
913403514 1:118462355-118462377 CCTGTTGCTCACACACATCCCGG - Intergenic
918240318 1:182615057-182615079 GCTGATGGTGCCACAGAGCCCGG - Intergenic
918708115 1:187693992-187694014 GTTGCTGGTGGCACACCCCCTGG - Intergenic
921889634 1:220340693-220340715 GCAGTTGGTGACCCAGCCCCTGG - Intergenic
922455187 1:225768574-225768596 GCTGTTGGTGACCCATACCCAGG + Intergenic
922629682 1:227093523-227093545 GCTATTGGTGACACTCAGTCTGG - Intronic
922903367 1:229155642-229155664 GCTGTGGCTGACACACAGCATGG + Intergenic
1063387649 10:5626135-5626157 GCTGTTGTTGATCCACACACGGG + Intergenic
1065845274 10:29737996-29738018 GATGTAGGTGACACACATCTTGG - Intergenic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1067374331 10:45713397-45713419 ACTGCTGGGGACACACACACTGG + Intergenic
1067379349 10:45758851-45758873 ACTGCTGGGGACACACACACTGG - Intronic
1067691484 10:48504788-48504810 GCAGGTGGTGACAGGCACCCAGG + Intronic
1067882166 10:50055151-50055173 ACTGCTGGGGACACACACACTGG + Intergenic
1067887049 10:50099513-50099535 ACTGCTGGGGACACACACACTGG - Intronic
1075977789 10:126711164-126711186 GCTGTAGGTTACACAGAGCCAGG + Intergenic
1077487170 11:2844340-2844362 GCTGCTGGTGACAGAGGCCCCGG - Intronic
1078463765 11:11535187-11535209 GCTGCTGGTGAGGCAGACCCTGG + Intronic
1078563092 11:12390105-12390127 TCTCTTGGTGACATAAACCCAGG + Intronic
1081704001 11:45170021-45170043 TTTGATGGTGACACACACTCTGG + Intronic
1083611980 11:64008643-64008665 GGTGTAGGAGACACACACACGGG + Intronic
1083725917 11:64628057-64628079 CCTCTTGGAGACACACACACAGG - Intronic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084815383 11:71642809-71642831 GCTGTGGGTCAGACACACCCTGG - Intergenic
1085676110 11:78520357-78520379 GATGTAGGAGACACACACACAGG - Intronic
1091684537 12:2552225-2552247 GGTGGTGGTGACACACAACAGGG + Intronic
1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG + Intergenic
1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG + Intergenic
1094676748 12:32628023-32628045 TCTGATGGTGACACAGTCCCGGG + Intronic
1096807942 12:54151688-54151710 ATTGTTGGGGACATACACCCAGG - Intergenic
1103852668 12:123943493-123943515 CCTGTGGGTAACACAGACCCTGG + Exonic
1103993845 12:124816567-124816589 GCTGTTGGAGACCCACAGTCTGG - Intronic
1104684188 12:130773695-130773717 GATGTTGATGACACAGAGCCTGG - Intergenic
1105277705 13:18945095-18945117 CGTGTTGGAGACACGCACCCTGG + Intergenic
1105913329 13:24891339-24891361 CCAGTTGGGGACACACACCTGGG - Intronic
1110925043 13:81140492-81140514 GATGTTTGTGACACAAACTCTGG + Intergenic
1113422941 13:110184059-110184081 GCTGTTGGTGACACACACCCTGG + Intronic
1114406761 14:22464028-22464050 GCTGCTGCTGACACCCAGCCAGG - Intergenic
1118819336 14:69334808-69334830 GCTGTTTGTGAGACAGCCCCTGG - Intronic
1122812253 14:104294960-104294982 GCAGTGGGTGACAGACACCAGGG + Intergenic
1202834409 14_GL000009v2_random:67261-67283 GCCCTTGGTGTCACAGACCCTGG + Intergenic
1124402690 15:29363946-29363968 GCTTTTGGTGCCACACACCTGGG + Intronic
1125449556 15:39794247-39794269 GCTGTTGGTGCCACACTGCTGGG - Intergenic
1128695113 15:69755911-69755933 GCTCTTGGTGAGACTCAGCCAGG + Intergenic
1132415785 15:101617888-101617910 GCTCTTGGTGACTGTCACCCTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133370616 16:5243138-5243160 GCTGTGGGTCAGACACACCCTGG - Intergenic
1133477041 16:6133746-6133768 ACAGTTGCTGAAACACACCCTGG + Intronic
1134114098 16:11535205-11535227 GCTGATGCTGACCCACACCCGGG - Intergenic
1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG + Intergenic
1141423586 16:83931983-83932005 GCTGTGGGTGGCACTCACCTGGG + Intronic
1146373677 17:32280671-32280693 GCTGTAAATGACACAAACCCTGG + Intronic
1150645602 17:66975880-66975902 GATGTTGGGAACACACACCTGGG - Intronic
1151668241 17:75557774-75557796 GCTGTTGGTGATAGGCCCCCTGG + Intronic
1152542384 17:80982769-80982791 CCTGCTGGGGACACTCACCCGGG - Intergenic
1155640633 18:28009743-28009765 GCTGTCGGTGACAAAGCCCCTGG - Exonic
1156363443 18:36404262-36404284 GGTGTTGGTGACATATCCCCTGG + Intronic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1160894767 19:1397249-1397271 GCTTCTGGTGACACACAGCTGGG + Intronic
1161164732 19:2780274-2780296 GCTGTTGGTGAGAAGCACCGTGG - Intronic
1161229062 19:3163387-3163409 TCTGTGGGTGACGCACACCCTGG + Exonic
1166803197 19:45470352-45470374 GCGGGTGGTGAATCACACCCCGG - Intronic
1167484883 19:49756740-49756762 GGACTTGGTGACTCACACCCAGG + Intronic
1167821762 19:51934806-51934828 GCTGTTTGAAATACACACCCTGG + Intronic
1202638274 1_KI270706v1_random:60431-60453 GCCCTTGGTGTCACAGACCCTGG - Intergenic
925991298 2:9257047-9257069 GCTGTTAGGGAAAGACACCCTGG - Intronic
927359650 2:22217912-22217934 GCTGTTGTAGACTCACAGCCAGG + Intergenic
931213078 2:60215682-60215704 GCTGTTGCTGGCAAACACTCTGG + Intergenic
935790966 2:106589751-106589773 ACTGTTGGTGAGACACACGGAGG + Intergenic
935987470 2:108688805-108688827 GCTGTTGATAACACACACAGCGG + Intergenic
936126296 2:109791502-109791524 GCTGTTGATAACACACACAGCGG + Intergenic
936218397 2:110579966-110579988 GCTGTTGATAACACACACAGCGG - Intergenic
936527629 2:113252426-113252448 GCAGTTGGAGGCACAGACCCTGG - Intronic
937267519 2:120625877-120625899 GCACCTGGTGACCCACACCCTGG - Intergenic
938589072 2:132719943-132719965 GTGATTGGTGACACACAGCCAGG + Intronic
943635393 2:190301383-190301405 GCTGTTGTTGACAAACACTAAGG - Intronic
946223581 2:218249713-218249735 GCGGTTGGGAACATACACCCTGG - Intronic
947642766 2:231716217-231716239 GCTGTTGGCTACACAGCCCCAGG + Intergenic
1169012204 20:2260090-2260112 CCTGTGGGTAACACACACCTTGG - Intergenic
1169872203 20:10259859-10259881 AGTGTTGATGACACAAACCCAGG - Intronic
1170596395 20:17809094-17809116 GCCGTGTGTGACACACACCAGGG + Intergenic
1171206647 20:23286886-23286908 GCTGGTGGTGATACTAACCCTGG - Intergenic
1173999348 20:47362990-47363012 GCTGCTGGTGCCACACTCTCTGG + Intergenic
1176937045 21:14879579-14879601 GCAGCTGGTGACCCAGACCCAGG + Intergenic
1177494040 21:21865797-21865819 GCTGTTTGTGTCACAGACACTGG + Intergenic
1180363691 22:11921448-11921470 GCCCTTGGTGTCACAGACCCTGG + Intergenic
1183891064 22:40929082-40929104 GCTGTTGGGGGCACAGAGCCTGG - Exonic
1184771565 22:46599924-46599946 GCCGGTGGTGAGACACACCTGGG - Intronic
950417487 3:12876578-12876600 GCTGTTGGTGACAGTACCCCAGG - Intergenic
950610957 3:14126143-14126165 GCTGTGGGTGATGCACACCCTGG - Intronic
952313822 3:32214958-32214980 GCTGTTTGTGGAACACTCCCAGG + Intergenic
954861819 3:53696623-53696645 GCTTTTGGTGACACATTCTCTGG - Intronic
957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG + Intergenic
960718107 3:120597708-120597730 GCTGTGGGTTACACAAACCAGGG - Intronic
961281740 3:125769837-125769859 GCTGTGGGTCAGACACACCCTGG - Intergenic
961785509 3:129344512-129344534 GCTGTTGGTGACAGTACCCCAGG - Intergenic
961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG + Intergenic
962859128 3:139381388-139381410 GCTGTTGGTGATATAAACACAGG + Intronic
965604864 3:170487889-170487911 GCTATTGGTGACACAGGCACAGG - Intronic
968600860 4:1508655-1508677 GCTGCTGGGGCCACACACCTGGG - Intergenic
968746661 4:2364043-2364065 GATGTTGGTGCCACAGCCCCAGG + Intronic
968877444 4:3280435-3280457 GCTGTGGCTCACACACAGCCAGG - Intergenic
968893707 4:3386076-3386098 CCTGTAAGTGACACACACACTGG - Intronic
969503664 4:7570485-7570507 GCAGATGGGGACACACACCAAGG - Intronic
969738030 4:9004103-9004125 GCTGTGGGTCAGACACACCCTGG - Intergenic
969797220 4:9535650-9535672 GCTGTGGGTCAGACACACCCTGG - Intergenic
980295619 4:130912299-130912321 TCTGTTGATGACACACACTGAGG - Intergenic
982240311 4:153293472-153293494 GCTGTTCCTGACACACATACAGG + Intronic
985391188 4:189492017-189492039 GCTGTGGCTGACCCTCACCCGGG + Intergenic
1202765613 4_GL000008v2_random:146289-146311 GCCCTTGGTGTCACAGACCCTGG - Intergenic
985532419 5:442105-442127 GCTGATGTTGACACTGACCCCGG - Exonic
985838762 5:2290099-2290121 GGTGCTGCTGACACACACCGAGG + Intergenic
987067225 5:14301794-14301816 GCTGTTGGTTTCACACCCTCTGG + Intronic
994089353 5:95795629-95795651 GATGTTGGTGTCACTCACACAGG - Exonic
1001555059 5:172631530-172631552 GCATTTGGTCACACAGACCCTGG - Intergenic
1002439514 5:179257082-179257104 GCCCTTGGTGACAGAGACCCCGG - Intronic
1003550869 6:7101071-7101093 TCTTTTGTTGCCACACACCCTGG + Intergenic
1005132844 6:22530793-22530815 GCTGTTGCTTGCACACACCAAGG - Intergenic
1005422394 6:25665617-25665639 TCTGTTGGTGAAAAACAACCAGG + Intronic
1007212895 6:40211148-40211170 GCGGTTGATGCCACACACACTGG + Intergenic
1007415274 6:41687948-41687970 GCTGCTGGTGACGCCCACCAGGG + Exonic
1016406924 6:143740850-143740872 TCTTTTGGTTACACACACCTGGG + Intronic
1018063386 6:160108056-160108078 CCTCCTGGTGACACACACACTGG - Intronic
1018066465 6:160127978-160128000 GCAGTTGGAGACACAAACCCTGG + Intronic
1018438056 6:163781325-163781347 GCTGTTTTTGACCCTCACCCTGG - Intergenic
1019177539 6:170167867-170167889 GCTGCTTTTGACACAGACCCAGG + Intergenic
1020715202 7:11665741-11665763 GCTTTTGGTCCCACACAACCTGG - Intronic
1026904411 7:74054712-74054734 GCTTCTGGTGACACAACCCCTGG - Exonic
1027192163 7:76003003-76003025 GCTGTTGGTGCCAGACAGGCAGG + Intronic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1029344778 7:99970675-99970697 CCTATTGCTGACACACAGCCTGG + Intronic
1033714536 7:143986043-143986065 GCTTTTGTTGACACACAGCAAGG + Intergenic
1034237655 7:149585256-149585278 GCTGCTGCAGACTCACACCCTGG + Intergenic
1034240736 7:149608915-149608937 GCTGCTGCAGACTCACACCCTGG + Intergenic
1034608318 7:152339342-152339364 TCTGTTGGTGACAAACACTTAGG - Intronic
1035378247 7:158421278-158421300 GATATTAGTGACACCCACCCTGG + Intronic
1035729141 8:1842378-1842400 GCTCTGCCTGACACACACCCAGG - Intronic
1036243114 8:7095377-7095399 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036257685 8:7218667-7218689 GCTGTGGGTCAGACACACACTGG + Intergenic
1036258936 8:7225666-7225688 GCTGTGGGTCAGACACACACTGG + Intergenic
1036307685 8:7613844-7613866 GCTGTGGGTCAGACACACACTGG - Intergenic
1036310989 8:7684262-7684284 GCTGTGGGTCAGACACACACTGG + Intergenic
1036358540 8:8061845-8061867 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036829619 8:12011794-12011816 GCTGTTGGTCAGATACACCCTGG + Intergenic
1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036892420 8:12605107-12605129 GCTGTGGGTCAGACACACACTGG + Intergenic
1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG + Intergenic
1044276681 8:90308699-90308721 ACTGTTGGTGACAGACAACAAGG - Intergenic
1044941005 8:97343694-97343716 GCTTTTGGTTACACACCACCTGG - Intergenic
1047185106 8:122626040-122626062 GCTGGTGGTGAAACAAGCCCAGG - Intergenic
1053421080 9:37978990-37979012 GCTGTTGGTGAGCCTCTCCCAGG - Intronic
1056311807 9:85348511-85348533 GCTGTGGCTGACACAGGCCCTGG + Intergenic
1059285464 9:113168355-113168377 CCTGTTGGTGGCCCACTCCCTGG - Intronic
1059722374 9:116973466-116973488 GCTGATGGTAACACATACTCTGG - Intronic
1061779912 9:132989339-132989361 GGTGTTGGAGACCCAGACCCAGG - Intronic
1062298479 9:135848660-135848682 GCTGTGGCTCACACACACCCAGG + Intronic
1203546358 Un_KI270743v1:131179-131201 GCCCTTGGTGTCACAGACCCTGG - Intergenic
1185628962 X:1502391-1502413 AGTGTTGGTGACACTCAGCCAGG + Intronic
1190059349 X:47200968-47200990 GCTGGTGGTGGCAGACACGCGGG + Exonic
1190929144 X:54933705-54933727 TCTGTTGGTGCAAAACACCCAGG + Intronic
1191210184 X:57876305-57876327 TCTGTGGATGACACAAACCCCGG + Intergenic
1200168917 X:154057942-154057964 GCTGGTTGGGACACCCACCCTGG + Intronic