ID: 1113423750

View in Genome Browser
Species Human (GRCh38)
Location 13:110190438-110190460
Sequence AAACCTGCTCAGACCAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113423746_1113423750 -4 Left 1113423746 13:110190419-110190441 CCAGTGACCAGGAACCATGAAAC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1113423744_1113423750 0 Left 1113423744 13:110190415-110190437 CCTCCCAGTGACCAGGAACCATG 0: 1
1: 0
2: 0
3: 13
4: 185
Right 1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 120
1113423745_1113423750 -3 Left 1113423745 13:110190418-110190440 CCCAGTGACCAGGAACCATGAAA 0: 1
1: 0
2: 0
3: 11
4: 242
Right 1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113423750 Original CRISPR AAACCTGCTCAGACCAACCT GGG Intronic
904200647 1:28817024-28817046 AAACCTGCTGAAACCTAGCTCGG - Intronic
904390350 1:30181188-30181210 ACACTGCCTCAGACCAACCTGGG - Intergenic
904906848 1:33903970-33903992 GAACCTGCTTAGCCCACCCTAGG + Intronic
904925972 1:34048512-34048534 ACAGCTGCTCAGGCCAACCTGGG + Intronic
906580304 1:46930353-46930375 AAACCTGCTCAGATCAGAATGGG - Intronic
906603420 1:47148537-47148559 AAACCTGCTCAGATCAGAATGGG + Intronic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
907143565 1:52211423-52211445 AACCCTGCTCAGACTAAGATTGG + Intronic
910341783 1:86196690-86196712 AATCTTGGTCAGGCCAACCTTGG - Intergenic
910666384 1:89729355-89729377 AAGCCTGCTTAGACCAACCCAGG - Intronic
910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG + Intronic
914784273 1:150814180-150814202 AAAGCTGCCCACACCAAACTGGG + Exonic
918715085 1:187775995-187776017 CATCCTGCTCAGTCCCACCTGGG + Intergenic
920469026 1:206210653-206210675 AAAACTGCTCAGACCTCCCAAGG - Intronic
920711526 1:208299990-208300012 AAACTTGGACAGACCAACTTTGG - Intergenic
920948780 1:210553753-210553775 AGAGCTGCTCAGACCACCCAGGG + Intronic
1063246398 10:4224176-4224198 AAAGCTACTCAGAACAACCACGG - Intergenic
1063381688 10:5589850-5589872 AAGCCTGCCCCGAACAACCTCGG - Intergenic
1064911231 10:20404242-20404264 AAACCTGGTCAGGGCAGCCTAGG - Intergenic
1066628066 10:37429645-37429667 ACACATGCTCAAATCAACCTTGG - Intergenic
1070942312 10:80358056-80358078 AAGCCCACTCAGACCAACTTAGG - Intronic
1072267859 10:93747719-93747741 AAACCTGCTAAGAACTATCTTGG + Intergenic
1074103106 10:110369070-110369092 AAACCTGCTCTGACTCCCCTAGG - Intergenic
1074944458 10:118268012-118268034 AAACCTTCTCAGATCCCCCTGGG - Intergenic
1076551375 10:131280094-131280116 CAAACTGCTCTGACCACCCTGGG - Intronic
1077052797 11:575419-575441 ACACCTGCGCAGACCCACCCGGG + Intergenic
1087184138 11:95168816-95168838 AAAGCTGCTTAGACCAAGATGGG + Exonic
1089388630 11:118084962-118084984 CAAACTGCAAAGACCAACCTAGG + Intronic
1089460784 11:118652213-118652235 AAACCTTCCCTGACCACCCTGGG + Intronic
1090840526 11:130483738-130483760 AAACTTGTAGAGACCAACCTAGG - Intergenic
1092100968 12:5883460-5883482 ACACATGCACAGACCACCCTAGG - Intronic
1093780956 12:23136806-23136828 GAAGCTGCTCAGACCGGCCTTGG - Intergenic
1099107717 12:78517728-78517750 AAATCTGCACAAAGCAACCTTGG - Intergenic
1099120788 12:78686883-78686905 AAAACAGCTCAGAGCAACCTGGG + Intergenic
1099286533 12:80718924-80718946 TCACCTCCTCAGAGCAACCTGGG + Exonic
1103618197 12:122168941-122168963 ACACCTGCCAAGCCCAACCTAGG - Intronic
1103929974 12:124444964-124444986 AGACCTGCTAAGAGTAACCTGGG + Intronic
1104389724 12:128381575-128381597 AAGCCTGCTCAGTCCTTCCTAGG + Intronic
1106361265 13:29033226-29033248 AAACTTGCTCAAACCTTCCTGGG + Intronic
1112604158 13:100887774-100887796 CAATCTGCACAGACCAACCTTGG - Intergenic
1113290214 13:108897342-108897364 AAAGCTCCTCAGGCCAACCCTGG - Intronic
1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG + Intronic
1114594739 14:23901884-23901906 AAACCTGTTCAGAGCAGCCCAGG + Intergenic
1116788614 14:49315541-49315563 AACCCTGCTCAGAAGAACTTAGG - Intergenic
1118110745 14:62716227-62716249 AAACCTTGTCAGATTAACCTTGG - Intronic
1118472673 14:66089552-66089574 AAACCAGCTCAGAGCATCCAGGG + Intergenic
1119898087 14:78237881-78237903 AAACCTGGTAAGCCCCACCTGGG + Intergenic
1121732360 14:96195389-96195411 AAAAATGCTCAGACCTCCCTGGG - Intergenic
1124806963 15:32893903-32893925 AAATCTGCCCATGCCAACCTAGG + Intronic
1124982662 15:34580400-34580422 CAACTTGCACAGCCCAACCTGGG + Intronic
1126548269 15:49897274-49897296 AAACATGCTTTTACCAACCTGGG + Exonic
1129485767 15:75870685-75870707 GAACAGGCTCAGAACAACCTTGG + Intronic
1137568330 16:49548179-49548201 AAGAATGCTCAGACCAAACTGGG - Intronic
1140407007 16:74717792-74717814 GAACCTGCTCAGGCCATTCTGGG - Intronic
1147228570 17:39000678-39000700 AAGCCTTCTCTGACCAGCCTGGG + Intergenic
1152899682 17:82933178-82933200 AACCCAGCTGAGACCAGCCTGGG - Intronic
1153231508 18:2941286-2941308 AAACCTTCTCAGATAATCCTTGG - Intronic
1158865301 18:61632565-61632587 AGACCTGCACAGCTCAACCTGGG - Intergenic
1163234384 19:16022442-16022464 AGCCCTGCTCAGCCCAAGCTCGG - Intergenic
1164800955 19:31076147-31076169 ACACCTGCCCAGACCAACACAGG + Intergenic
1166003155 19:39890140-39890162 AAAACTGCTCAGGCCAACTTGGG + Intronic
1167216240 19:48167323-48167345 AGACCAGCTCAGACCAGCCTGGG + Intronic
1168452854 19:56479265-56479287 AAACTTGCTCAGAGTCACCTGGG - Intergenic
926629193 2:15121361-15121383 CAACCTGCTCAGACAAGCCATGG + Intergenic
927146864 2:20171916-20171938 AAGCCTGCTGAGCCCAGCCTGGG + Intergenic
928530885 2:32189816-32189838 AAACCAGTTCAAACCAGCCTGGG - Intronic
929578188 2:43065921-43065943 AAACCTGGCCAGCCCCACCTTGG + Intergenic
929682574 2:44006369-44006391 AAACCTATTCAGTCCATCCTGGG - Intergenic
930004135 2:46882526-46882548 AATCCTGCTCTGGCCAACCCCGG - Intergenic
931985191 2:67734605-67734627 AACCTTGCTCACACCCACCTTGG + Intergenic
935715310 2:105934099-105934121 ACACCTGGTCAAACCAATCTGGG - Intergenic
945357131 2:208854208-208854230 AAACCTCCTCAGGCTAACATTGG - Intronic
945999364 2:216468090-216468112 AAGCCTGCTTAGAACAACTTGGG - Intronic
948019654 2:234720055-234720077 AAAACTGCTCAGACTGAACTAGG - Intergenic
1172153002 20:32803764-32803786 AGACCAGCTCAGAGCACCCTAGG + Intronic
1172928413 20:38562624-38562646 AAACATGCCCAGTCCAACCAGGG - Exonic
1173394769 20:42669049-42669071 AAACCTGCTCTGATCATACTCGG - Intronic
1173974293 20:47175395-47175417 TAACCTGCTCAGAGCTACATGGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1181419414 22:22787426-22787448 AAACCTACTCAGAACCCCCTGGG + Intronic
1185044382 22:48521913-48521935 GCTCCTGCTCAGACCAAACTCGG + Intronic
949897325 3:8777988-8778010 AAGCCTCCACAGACCAGCCTGGG + Intronic
954575558 3:51674168-51674190 CAACCTCCTCAGACCTGCCTTGG - Intronic
955762401 3:62301515-62301537 GAACATGCTAAGAACAACCTGGG + Intergenic
956703272 3:71977462-71977484 AAACCTACTCAGACTAGCATAGG - Intergenic
961332925 3:126153641-126153663 AGCCCTGCTCAGACCTGCCTGGG - Intronic
963509589 3:146230376-146230398 AAACCTGCACAGACACACATAGG - Intronic
965442543 3:168733134-168733156 AAACCTGAACAGACCAACAGTGG + Intergenic
966252686 3:177884380-177884402 AAACCTGCTCATCCAAAACTTGG + Intergenic
968657692 4:1785701-1785723 AAACCTGCTGAGCCCCAGCTGGG - Intergenic
972188018 4:36555656-36555678 AAACGTGCTCTGACCACCTTGGG + Intergenic
972647706 4:40984687-40984709 AAAACTGCCCAGACAAAGCTGGG + Intronic
975226394 4:71877309-71877331 AAACCTGAACAGACCAACAATGG - Intergenic
980160061 4:129150200-129150222 AATCCTGCTCAGGGCATCCTGGG - Intergenic
986988056 5:13521420-13521442 AACTATGCTCAGACCACCCTGGG + Intergenic
989239075 5:39182888-39182910 AACCCTGCTCTGAACAACTTTGG - Intronic
992401618 5:76417038-76417060 AAAGAAGCTCAGACCAGCCTGGG - Intronic
992827388 5:80564403-80564425 GAACCTCCTGACACCAACCTTGG - Intronic
999432219 5:151534391-151534413 AATCCTTCTCAGACTCACCTTGG + Exonic
1001582322 5:172807278-172807300 AAGCCTGCTGAAACCACCCTTGG - Intergenic
1006448168 6:34091415-34091437 AAACCAGCACAGACCACCCGCGG + Intronic
1013363592 6:109417787-109417809 ACACCTGTCCAGTCCAACCTTGG + Intronic
1018003633 6:159601029-159601051 AGACATTTTCAGACCAACCTGGG + Intergenic
1018618858 6:165711715-165711737 AAGCCTGTTCAGAACAACCCAGG + Intronic
1019719513 7:2559621-2559643 AAGCCTCCTCTGACCAAGCTGGG - Intronic
1025121271 7:56305987-56306009 AAAGTTTCTCAGACCAACCTTGG + Intergenic
1027222773 7:76224427-76224449 AAACCTTCCCTGACCATCCTAGG + Intronic
1031422876 7:121570188-121570210 AACCATGCTCAGTCCAACCTTGG + Intergenic
1032616531 7:133478467-133478489 AGACCTGCTCAGACACACATGGG - Intronic
1032819764 7:135513645-135513667 AAACCTGCCAAAACCAGCCTAGG + Intergenic
1032831911 7:135636197-135636219 AAAGATGCTCAGACCAAACCAGG - Intronic
1034954914 7:155328129-155328151 ACCCCTGCTCAGACCACCCCGGG + Intergenic
1034979909 7:155468774-155468796 AAACCCTCTCAGAAAAACCTCGG - Intergenic
1035305905 7:157931179-157931201 GAACCAGCTCAGAGCAGCCTGGG - Intronic
1041082337 8:54225672-54225694 ATACCTGATCAGAGAAACCTGGG + Intergenic
1041296258 8:56360256-56360278 AAACCTGATCAGACTAACAGTGG - Intergenic
1050128443 9:2383930-2383952 GAAACAGCTGAGACCAACCTAGG + Intergenic
1057277049 9:93681507-93681529 GAACTTGCTCAGGCCAAGCTGGG - Intergenic
1060157010 9:121327006-121327028 TAGGCTGCTCAGACCATCCTGGG - Intronic
1062166350 9:135109522-135109544 GAGCCTGCTCAGAGCACCCTCGG + Intronic
1185925357 X:4139821-4139843 AAACCTGTTCTGACCAATCCCGG - Intergenic
1187383570 X:18827461-18827483 AAACCTGATGTCACCAACCTTGG + Exonic
1189332752 X:40153434-40153456 ATGCCTGCTCAGACCGGCCTGGG - Intronic
1192607581 X:72535069-72535091 AAACTTGCTAAGCCCAACCCTGG - Intronic
1201984111 Y:19944609-19944631 AAACCTGAACAGACCAACAATGG - Intergenic