ID: 1113424077

View in Genome Browser
Species Human (GRCh38)
Location 13:110193606-110193628
Sequence CGCCTCGATGTCCCTGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113424077_1113424083 9 Left 1113424077 13:110193606-110193628 CCCATGCCAGGGACATCGAGGCG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1113424083 13:110193638-110193660 TGTTCTTCCCATCCCTGCCCTGG 0: 1
1: 1
2: 1
3: 41
4: 364
1113424077_1113424084 13 Left 1113424077 13:110193606-110193628 CCCATGCCAGGGACATCGAGGCG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1113424084 13:110193642-110193664 CTTCCCATCCCTGCCCTGGCTGG 0: 1
1: 0
2: 3
3: 55
4: 560
1113424077_1113424090 26 Left 1113424077 13:110193606-110193628 CCCATGCCAGGGACATCGAGGCG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1113424090 13:110193655-110193677 CCCTGGCTGGCAGCCGCACACGG 0: 1
1: 0
2: 1
3: 18
4: 222
1113424077_1113424092 27 Left 1113424077 13:110193606-110193628 CCCATGCCAGGGACATCGAGGCG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1113424092 13:110193656-110193678 CCTGGCTGGCAGCCGCACACGGG 0: 1
1: 0
2: 1
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113424077 Original CRISPR CGCCTCGATGTCCCTGGCAT GGG (reversed) Intronic
900157824 1:1210671-1210693 GGCCCCTATGTCCCTGCCATAGG - Intergenic
900458294 1:2787789-2787811 CGTCTCCATGTACCTGGCCTGGG + Intronic
902896759 1:19485090-19485112 CCCCTCGGTGACCCTGGCGTGGG - Intronic
903090589 1:20912193-20912215 AGCCTCAATGTCCCAGGCTTGGG - Intronic
910262316 1:85304350-85304372 GGCCTTGATGTCCCTGGCCTTGG - Intergenic
910347626 1:86258541-86258563 TGCCCTGATGTCTCTGGCATAGG - Intergenic
918214992 1:182385832-182385854 CTCCACGATGTCCCTGCCATAGG + Exonic
1062919349 10:1267491-1267513 TGCCTCGATGGGCCTGGCCTGGG + Intronic
1069474634 10:68721600-68721622 CGCCACGATGTCCCGGGCCGGGG - Intronic
1069912930 10:71770862-71770884 CCCTTGGGTGTCCCTGGCATTGG + Intronic
1070329136 10:75405496-75405518 CGCCTCGCGGTCCCTGGGAGCGG + Intergenic
1072160099 10:92758056-92758078 TGCCTCTCTGTCCCTGGCATGGG + Intergenic
1072942556 10:99779849-99779871 TGCTTCCATGTCCCTGGCAGAGG - Intergenic
1078286335 11:9959277-9959299 CTCCACAATGTCCCTGCCATAGG + Intronic
1084268061 11:68015031-68015053 CGCCTCCAGGTCCATGGCAGAGG + Intronic
1084792221 11:71482115-71482137 CACCCCGATGTCCATGGCACGGG - Intronic
1086883741 11:92179872-92179894 AGCCTCGACCTCCCAGGCATAGG + Intergenic
1092859007 12:12703277-12703299 TGCCTCTATGTCTGTGGCATTGG + Intergenic
1096478888 12:51924882-51924904 CGCCTAGAAGTCCCTGTCCTGGG + Intergenic
1097540434 12:60936253-60936275 TGCTCCGATGTCCCTGGCAATGG + Intergenic
1099615310 12:84927000-84927022 TGCATCCATGTACCTGGCATGGG + Intergenic
1101100363 12:101385367-101385389 AGCCTCTATGTTCCTGGGATGGG - Intronic
1102949235 12:117018359-117018381 CTCCTCTTTGTCCCTGGAATCGG + Intronic
1106200926 13:27536700-27536722 AGCCTTGATGCCGCTGGCATTGG + Intergenic
1108080840 13:46733365-46733387 TGCCTCTATATCCCTGGCTTTGG + Intronic
1113424077 13:110193606-110193628 CGCCTCGATGTCCCTGGCATGGG - Intronic
1118989217 14:70782737-70782759 CACCTCCATGTCCATTGCATGGG + Intronic
1121331265 14:93051185-93051207 TGCCTCAATTTCCCAGGCATGGG + Intronic
1121639751 14:95477312-95477334 GGCCTCTCTCTCCCTGGCATTGG + Intergenic
1130096660 15:80861253-80861275 CTCCTCCCTGTCCCTGGCAGTGG + Intronic
1132880849 16:2161094-2161116 CGCCTCCATGTCCCTGGCTGGGG + Intronic
1132955836 16:2592960-2592982 GGCTTCAGTGTCCCTGGCATGGG + Intronic
1132983267 16:2750129-2750151 CTCCTGGAGATCCCTGGCATGGG + Intergenic
1133037673 16:3043386-3043408 TGCCTCACTGTCCCTGGCACAGG + Intergenic
1139073950 16:63419928-63419950 CTCCTCTCTTTCCCTGGCATAGG + Intergenic
1141402881 16:83766123-83766145 CCTCTCTATGTCCCTGGTATGGG + Intronic
1141507104 16:84485119-84485141 TGCCTCCATGTCACAGGCATAGG - Intronic
1143252121 17:5531295-5531317 AGCCTCGAAATCCCTGGCTTAGG + Intronic
1144946356 17:18971497-18971519 CTCCTCGGTGGCCCTGCCATCGG + Exonic
1149980190 17:61304652-61304674 CACCTCAATGTCCCTGACACAGG + Intronic
1151680403 17:75619965-75619987 CGCCTCGATGGCCCTTGCCCGGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152579510 17:81159870-81159892 CCCCTCCCTGTCCCTGGTATCGG - Intronic
1155142300 18:23054342-23054364 CGCGTCGTTGTCGCTGGCAGGGG + Intergenic
1160471514 18:79138984-79139006 GGCCTCGATCTCCCTGGCTCGGG - Intronic
1160863898 19:1249008-1249030 CGCCGCGCTGCCCCTGGCAGGGG - Intronic
1164432618 19:28201285-28201307 CGCCTGGCAGTCCCTGGCCTGGG + Intergenic
1165472350 19:36010756-36010778 CACCTCCCTGTCCCTGGCTTGGG - Intronic
1168231113 19:55032304-55032326 CGCCCGGAGGTCCCTGGCACCGG + Exonic
1168609328 19:57786614-57786636 CGCCTCTAGGTCCCTGACAGAGG - Intronic
926009180 2:9394980-9395002 CACCTACATGTCCCTGGCATGGG + Intronic
926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG + Intergenic
931050295 2:58406580-58406602 AGCCTCGATCTCCCAGGCTTGGG + Intergenic
933282201 2:80344564-80344586 AGCCTCGATCTCCCAGGCACAGG + Intronic
939689666 2:145242148-145242170 AGCCTCGACCTCCCTGGCTTAGG + Intergenic
941704602 2:168644580-168644602 CTCCTTGTTGTCCCTGGCATTGG + Intronic
944414668 2:199469642-199469664 GGCCTCTAGGTCCCTGGCCTCGG - Intronic
947838095 2:233189510-233189532 CTCCTCTATGACCCTGGCCTAGG + Intronic
1169948584 20:11016007-11016029 ATCCTCCATTTCCCTGGCATGGG + Intergenic
1176430289 21:6571249-6571271 CCCCACGATGACCCTGGCAGTGG + Intergenic
1179499485 21:41798452-41798474 CGCCTCGCTGTGTCCGGCATGGG - Intronic
1179705683 21:43178711-43178733 CCCCACGATGACCCTGGCAGTGG + Intergenic
1182465160 22:30511030-30511052 AGCCTCGATCTCCCTGGCTCAGG - Intergenic
960636149 3:119786833-119786855 CTCCTCACTGGCCCTGGCATGGG - Intronic
968614266 4:1570350-1570372 ACCCTCCATGTGCCTGGCATTGG + Intergenic
969538756 4:7772824-7772846 GGACTCGATGTCCCTGACTTGGG + Exonic
969874360 4:10124836-10124858 TGTCTCAATGTCCCTGGCTTGGG + Intergenic
992431416 5:76715133-76715155 AGCCTCGATCTCCCTGGCTCAGG - Intergenic
999470442 5:151850183-151850205 CTCCACGATGTCCCTGCCATGGG - Intronic
1010727943 6:79356393-79356415 CCCCTTCATGTCCCTGGAATGGG - Intergenic
1016913944 6:149227391-149227413 CCCCTTGATGTCCCAGACATAGG + Intronic
1022473194 7:30694282-30694304 CGCCTCTCAGTGCCTGGCATGGG + Intronic
1024808827 7:53183122-53183144 TGACTCGATATCTCTGGCATTGG + Intergenic
1025209866 7:57014248-57014270 GCCCTCGGTGTCCCTGGCAGTGG + Intergenic
1032188753 7:129750394-129750416 AGCCTTCATGTCCCTGGCAAGGG - Intronic
1039353556 8:36789888-36789910 GCCCTCCATGTCCCTAGCATAGG - Intronic
1053045983 9:34917685-34917707 CTCCACGATGTCCCTGCCATAGG - Intergenic
1055116643 9:72612250-72612272 AGCCTTGATCTCCCTGGCTTAGG + Intronic
1057849771 9:98556327-98556349 AGCCCCGGTGTCCCTGGGATTGG - Intronic
1059346957 9:113635579-113635601 TGCCTTTATGTCCCTGGAATGGG - Intergenic
1059646918 9:116276847-116276869 CTCCTCGATGTCCCTCACAGGGG - Intronic
1186552539 X:10521919-10521941 AGCCTCGATTTCCCAGGCTTGGG + Intronic
1195941860 X:110173849-110173871 AGCCTGGAGGTCCCTGGCAGTGG - Exonic
1198183202 X:134230101-134230123 CACCTCAATGTGCCTGGAATTGG - Intergenic