ID: 1113424790

View in Genome Browser
Species Human (GRCh38)
Location 13:110199164-110199186
Sequence ATGTGCCCCTGGGAGAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113424786_1113424790 4 Left 1113424786 13:110199137-110199159 CCACTGTAACTCTGTAAGGGTAA 0: 1
1: 0
2: 2
3: 9
4: 96
Right 1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG 0: 1
1: 0
2: 1
3: 33
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113424790 Original CRISPR ATGTGCCCCTGGGAGAGCTG AGG Intronic
900499191 1:2991861-2991883 AGGAGCCCCTGGGACATCTGGGG - Intergenic
900503698 1:3018790-3018812 AGGTGGCCCTGGGCGGGCTGGGG - Intergenic
900578390 1:3395414-3395436 ACCTGCCCCTGCGAGACCTGGGG - Intronic
901072217 1:6526756-6526778 CTGTGCCCCCGGAAGAGCTAAGG - Exonic
902443132 1:16444274-16444296 CTGTGCCTCTGGGTGAGCTGTGG + Intronic
902631190 1:17705603-17705625 ATCTGGTCCTGGGAGGGCTGAGG + Intergenic
902638084 1:17748133-17748155 GTTTGCCCCTGGGTGAGGTGAGG - Intergenic
903339456 1:22644537-22644559 ATGGGCACCTGGGGAAGCTGGGG + Intronic
907569060 1:55466287-55466309 ATGTGCCACAGGCAGAGCCGGGG + Intergenic
909552145 1:76910076-76910098 ATGTTACACTGGGAGACCTGAGG - Intronic
910210061 1:84783353-84783375 AAGGTCCCCTGGGAGAGGTGGGG - Intergenic
911070284 1:93826848-93826870 ATGTGTACCTGGGAGGGCAGGGG + Intronic
913611346 1:120512566-120512588 AGGTGCTGCTGGGAGAGCGGTGG + Intergenic
914579846 1:149009673-149009695 AGGTGCTGCTGGGAGAGCGGTGG - Exonic
915162948 1:153932646-153932668 ATGTGCCCGTTGCAGAGCTGGGG + Exonic
916197587 1:162239240-162239262 AGGTGCCTCTAGGAGAGCCGAGG + Intronic
919540274 1:198836945-198836967 ATGTTCTCCTGGAAGAGGTGGGG - Intergenic
919833019 1:201555467-201555489 CTGGGGGCCTGGGAGAGCTGTGG + Intergenic
920022212 1:202965078-202965100 TTGCCCCCCTGGGTGAGCTGTGG - Intronic
1064394984 10:14974506-14974528 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1064396032 10:14982635-14982657 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1064397732 10:14994822-14994844 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1065973043 10:30819974-30819996 ATGTGTCCCTGGCAGAGACGAGG - Intergenic
1066157414 10:32692766-32692788 ATGGGACACTGGTAGAGCTGGGG - Intronic
1066385961 10:34941290-34941312 TTGTTCCCCTGAGTGAGCTGAGG - Intergenic
1066389928 10:34970367-34970389 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1067568997 10:47358187-47358209 GTGTGACCTTGGGTGAGCTGCGG - Intergenic
1068918385 10:62457973-62457995 ATGTCTCCCTGGGAGAGCTAAGG - Intronic
1070698823 10:78583998-78584020 ATGTGTCCCTGGCAGGGCAGAGG - Intergenic
1071171972 10:82877272-82877294 TTGAGCCCCTGTGAGAGCTCAGG + Intronic
1071689240 10:87797967-87797989 AGGTGCCCCTGGGTGACCGGGGG + Intronic
1072627472 10:97122382-97122404 CTGTTTCCCTTGGAGAGCTGGGG - Intronic
1073328438 10:102656150-102656172 ATGTGCCCCCGGGAGGGCTAGGG - Intronic
1074899182 10:117801954-117801976 CTCAGGCCCTGGGAGAGCTGCGG + Intergenic
1076021352 10:127076588-127076610 GTGTGCCCCAGGGAGTGGTGAGG + Intronic
1076310367 10:129501987-129502009 ATGTGATACTGGGACAGCTGTGG + Intronic
1077212018 11:1375478-1375500 GGGTGCCCCAGGGTGAGCTGGGG + Intergenic
1077589486 11:3480558-3480580 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1078579534 11:12527605-12527627 AAGAGCCCCTGGGACAGGTGGGG + Intronic
1080723335 11:34870667-34870689 AGCTGCCCCAGGGAGAGCTCTGG + Intronic
1083150048 11:60786302-60786324 ATGTGTCCATGGGAGGTCTGTGG - Intronic
1083489997 11:63009133-63009155 ATGAGCCCCCGGCAGGGCTGAGG + Intronic
1083899249 11:65635787-65635809 CTGCGCACCTGGGAGAGGTGAGG + Exonic
1084228210 11:67730799-67730821 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084235530 11:67785806-67785828 CTGTGCCCCTGGGTAAGTTGGGG + Intergenic
1084245207 11:67852332-67852354 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084261612 11:67982487-67982509 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084383828 11:68829771-68829793 GTGTGCCCCTGGGCCAGCTATGG + Intronic
1084696034 11:70756139-70756161 ACCTGCCTCTGGGGGAGCTGGGG - Intronic
1084765559 11:71305951-71305973 AAGTGCCACTGGAAGGGCTGTGG + Intergenic
1084827481 11:71742246-71742268 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1084964752 11:72738782-72738804 GTGTGGCCCTGGGAGATGTGTGG - Intronic
1085010821 11:73141104-73141126 CTCGGCCCCTGGGAAAGCTGGGG + Intronic
1087137379 11:94734648-94734670 ATGCTCCCCTGGGAGAGGAGGGG + Intronic
1089735827 11:120549686-120549708 GTGGGCCCCTGGGAGATCTGGGG + Intronic
1090423580 11:126592040-126592062 AGGAGTCCCTGGGACAGCTGAGG + Intronic
1091100549 11:132868957-132868979 ATGCGCCCCTGGAGAAGCTGTGG + Intronic
1091387773 12:105457-105479 GTGTGCTCCTGGGTGATCTGAGG + Intronic
1092304205 12:7282858-7282880 AGGTGCCCCTGGGTGACCAGAGG + Intergenic
1092355053 12:7787806-7787828 ACCTGCCCTTTGGAGAGCTGCGG + Intronic
1092432901 12:8423049-8423071 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1092435494 12:8443678-8443700 AAGTGCCCCTGAGAGAGCAGCGG - Intergenic
1092499459 12:9031145-9031167 AGGTGCCCCTGGGTGACCAGGGG - Intergenic
1094716229 12:33017658-33017680 CTGTGCACCTGGTAAAGCTGTGG + Intergenic
1096258798 12:50078403-50078425 ATGAGCTGCTGGGAGAGCCGGGG - Exonic
1096592195 12:52667747-52667769 GTGGGCCCCTGGGAGGGGTGGGG + Intergenic
1096657281 12:53099394-53099416 ATGTGCTCCTGGGACCACTGGGG + Intronic
1098666053 12:73164138-73164160 AGGTGCCCCTGGGTGACCAGGGG + Intergenic
1100361053 12:93879810-93879832 ATGTGCCACTGGGAGAGGTGGGG + Intronic
1101906195 12:108828320-108828342 ATGTGCTCCTAGGCAAGCTGGGG - Intronic
1102624548 12:114224601-114224623 GTGTGACCCTGGGACAGGTGTGG + Intergenic
1104715760 12:131015237-131015259 TTGTGCTGCTGGGTGAGCTGGGG + Intronic
1104850136 12:131868754-131868776 ACGTGGGCCTGGCAGAGCTGGGG - Intergenic
1104963239 12:132498019-132498041 CTGCACCCCTGGGAGAGCTGGGG + Intronic
1104981509 12:132574974-132574996 ATGTGCACCTGGGAAGGCTGAGG + Intronic
1106485148 13:30165969-30165991 GTGTCCCTCTGGGAGAGCAGAGG + Intergenic
1106620165 13:31364909-31364931 CTGTGCTCCTGGGGGAGCTTGGG + Intergenic
1107544665 13:41424577-41424599 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1110951279 13:81494889-81494911 ATGTGCACTGGGGAGAGATGTGG + Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1113589580 13:111488989-111489011 AGGTGCCCCTGGGGCAGCTGAGG - Intergenic
1113847901 13:113402964-113402986 AGGTGGCCCTGTGAGAGCTGGGG + Intergenic
1114079999 14:19195562-19195584 ATGTGCCCCTGGGTGACAAGGGG - Intergenic
1114550263 14:23528731-23528753 CTGGGCCACTGGGGGAGCTGTGG - Intronic
1114620563 14:24094043-24094065 ATGTGCGGCTGGGAGGGCGGTGG + Intronic
1114644808 14:24249428-24249450 CCGTGCACCTGGGAGAGCTGTGG + Exonic
1118455578 14:65943253-65943275 ATGCTCACCTGGGAGGGCTGTGG + Intergenic
1119666201 14:76486786-76486808 CCGTGCCCCTGGGAGTGCAGGGG - Intronic
1121258198 14:92546845-92546867 AGGTGTCCCTGGGAGAGATAGGG + Intronic
1121299686 14:92860756-92860778 ATGTTCCCCTGGGAGTCCTTGGG - Intergenic
1121619820 14:95338351-95338373 ATCTCCCCATGGGAGAGATGAGG - Intergenic
1122277904 14:100604604-100604626 CTGTGCCCCAGGGTGAGGTGGGG - Intergenic
1122416241 14:101550881-101550903 CTGTGCCCTTTGCAGAGCTGTGG - Intergenic
1122689729 14:103526456-103526478 GTGGGCCCCAGGGAGAGCAGGGG - Intergenic
1122763570 14:104048900-104048922 TTATGGCCCTGGGAGTGCTGTGG + Intronic
1122823617 14:104359236-104359258 CTCGGCCCCTGGCAGAGCTGGGG + Intergenic
1123058039 14:105581654-105581676 AAGGGCCCTGGGGAGAGCTGAGG + Intergenic
1125210500 15:37209494-37209516 ATGGGCCCATGGGATATCTGGGG + Intergenic
1126122214 15:45263746-45263768 ATGTGCCATTGTTAGAGCTGTGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1126800867 15:52295574-52295596 CTGGGCTCCTGGGAGCGCTGTGG - Intronic
1131943891 15:97597989-97598011 CGGTGCCCCAGGGAGAGCTGGGG - Intergenic
1132214747 15:100054262-100054284 AGGATCCCCAGGGAGAGCTGTGG + Intronic
1133255660 16:4514283-4514305 AGGTGGCCCTGGGAAAGGTGGGG - Intronic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1134109598 16:11506863-11506885 CTGGGCCCCCGGGAGGGCTGAGG - Intronic
1134264361 16:12680723-12680745 CTCTGCCCCTGTGAGACCTGGGG + Intronic
1135225251 16:20650356-20650378 AGGTGCCCCTGGGTGATCAGGGG + Intronic
1135590474 16:23701515-23701537 ATGTGCTCCTGGGAGAGGTTTGG - Intronic
1136093083 16:27934647-27934669 ATGGCACCATGGGAGAGCTGTGG + Intronic
1136498613 16:30658862-30658884 CTGTGCCGTTGGGAGAACTGGGG + Exonic
1136716925 16:32288861-32288883 GGGTGCCCCTGGGGGACCTGGGG + Intergenic
1136835300 16:33495106-33495128 GGGTGCCCCTGGGGGACCTGGGG + Intergenic
1138338004 16:56268013-56268035 ATGCTCCCCTGGGAGAGGGGAGG - Intronic
1138396000 16:56705339-56705361 ATGTACCCTTGGGAGTACTGGGG + Intronic
1138730121 16:59185074-59185096 AGCTGCCCCTGGGACAACTGAGG + Intergenic
1139485726 16:67255638-67255660 TTGAGCCCCTGGGAGTGCGGTGG + Intronic
1139934190 16:70556249-70556271 ATGTACCCCCTGGAGAGCAGCGG + Exonic
1139936762 16:70577228-70577250 CTCTGGCCCTGGGAGATCTGGGG + Exonic
1140259475 16:73364998-73365020 ATGTGCCCTTGGGGCATCTGGGG + Intergenic
1140503739 16:75456740-75456762 ATGTGCACCTGCCAGAGCTCTGG + Intronic
1140511034 16:75508712-75508734 ATGTGCACCTGCCAGAGCTCTGG + Intergenic
1140754987 16:78058976-78058998 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1141151792 16:81569435-81569457 ATGTCCCTCTGGGAGAGCCAGGG - Intronic
1141299323 16:82798739-82798761 ACATGCCCCAGGTAGAGCTGGGG + Intronic
1141716514 16:85730090-85730112 CAGAGCCCCTGGGGGAGCTGAGG + Intronic
1203009503 16_KI270728v1_random:228926-228948 GGGTGCCCCTGGGGGACCTGGGG - Intergenic
1203145473 16_KI270728v1_random:1795427-1795449 GGGTGCCCCTGGGGGACCTGGGG + Intergenic
1144825023 17:18100956-18100978 AGAAGCCCCAGGGAGAGCTGGGG + Intronic
1146441875 17:32904153-32904175 AGGTGCCCCTGGGTGACCGGGGG - Intergenic
1147137717 17:38443747-38443769 ATGTGCCCCCGGGAGACTTTCGG + Intronic
1147375856 17:40022210-40022232 TTGTGCCCATGGGCAAGCTGGGG + Intronic
1148079403 17:44959659-44959681 CTGTGCCCTGGGGAGGGCTGCGG - Intergenic
1148359011 17:46996484-46996506 ATGTGCAGATGGGACAGCTGAGG - Intronic
1148714426 17:49705722-49705744 ATGGGCAGCAGGGAGAGCTGGGG + Intronic
1148776617 17:50099285-50099307 CCGTGTTCCTGGGAGAGCTGAGG + Intronic
1150473604 17:65457880-65457902 AGGTGGCCCTGGGACAGGTGGGG - Intergenic
1150478360 17:65490792-65490814 AGGTGCCCATGGGAGAGCAAGGG - Intergenic
1151176074 17:72289128-72289150 AGATGCCCATGGGTGAGCTGAGG - Intergenic
1152558491 17:81066477-81066499 ATGCCCACCTGGGAGAGCTGGGG + Intronic
1155152585 18:23135088-23135110 CTGTGCTCCTGGGAGAGTTGTGG - Intronic
1155607109 18:27619419-27619441 ATATGTCCCTGGGAGTGTTGAGG + Intergenic
1156346917 18:36265491-36265513 ATTTGCCCGTGAGTGAGCTGAGG + Intronic
1157669598 18:49517242-49517264 AAGTGTCCATGGGAGAGCTACGG + Intergenic
1158632817 18:59131218-59131240 ATGTTCCACTGGGAAAGCTTAGG + Intergenic
1159028215 18:63206133-63206155 ACATCCCCCTGGGAGAGGTGTGG - Intronic
1161775809 19:6261462-6261484 AGGTGTCCCTGGGAGGCCTGTGG - Intronic
1163142658 19:15360879-15360901 AGGTGCCGCTGGAGGAGCTGCGG + Exonic
1163159504 19:15456491-15456513 AGGAGACCCTGGGTGAGCTGGGG - Exonic
1163312384 19:16522129-16522151 ATGGGCAGCAGGGAGAGCTGCGG - Intronic
1163469020 19:17486291-17486313 TGGTGGCCCTGGGGGAGCTGGGG - Intronic
1163524305 19:17811353-17811375 ATGTGCCTCTAGGAGTGTTGGGG - Intronic
1164741536 19:30579709-30579731 ATGTGCCCCTTGGGGATGTGGGG - Intronic
1165226715 19:34360042-34360064 ATGTGGCCCTGAGAGAGGAGCGG - Intronic
1165452253 19:35890392-35890414 AGCTGCCCCGGGGAGACCTGCGG - Exonic
1165726276 19:38115184-38115206 CTGTGGCCCTGGGAGAGGGGCGG + Intronic
1166144615 19:40825368-40825390 TTCTTTCCCTGGGAGAGCTGGGG + Intronic
1166183128 19:41122693-41122715 TTCTTTCCCTGGGAGAGCTGGGG - Intronic
1166320792 19:42017733-42017755 ATGTGCGCCTGGTGCAGCTGGGG + Intronic
927060816 2:19417497-19417519 ATCTTCACCTGGGAGAGCTACGG + Intergenic
927200902 2:20577543-20577565 CTATGCCCCTGGTGGAGCTGGGG - Intronic
927289584 2:21392716-21392738 ATGTGCCCCTGGGCAGCCTGGGG - Intergenic
928313784 2:30231301-30231323 GTGTGCGCGTGGGAGAGCGGCGG + Intergenic
930766393 2:55089851-55089873 AGGTCCCCCTGGGACACCTGGGG + Intronic
931382108 2:61763872-61763894 CTGGGCTCCTCGGAGAGCTGTGG - Intergenic
931779646 2:65567932-65567954 ATGTCACCATGTGAGAGCTGTGG - Intergenic
932346929 2:71001667-71001689 CTGTGCTCCTGGGAGGCCTGGGG - Intergenic
932353006 2:71046932-71046954 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
932719971 2:74131589-74131611 ATGTGCCCAGGGGAGGGCTGTGG + Intronic
933399105 2:81768753-81768775 ATGTGTCTGTGGGTGAGCTGGGG - Intergenic
933891419 2:86774923-86774945 ATGTTTACCTGGGAGAGCTGGGG + Exonic
934774114 2:96926476-96926498 TTGTGCTCCTGGGGGAGATGGGG + Intronic
935082466 2:99811628-99811650 GTATGCCCCTTGCAGAGCTGAGG + Intronic
935251454 2:101265603-101265625 GTTTGTCCCTGGGAGAGGTGGGG + Intronic
937971025 2:127549668-127549690 ATGTGCCCATGGCATATCTGAGG + Intronic
940800161 2:158124287-158124309 ATGTGCCACTTGGATATCTGGGG + Intronic
940871704 2:158866228-158866250 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
940873926 2:158882231-158882253 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
942178230 2:173355133-173355155 TTGTGCACCTGGGATAACTGAGG + Intronic
945041340 2:205745952-205745974 ACGAGGCCCTGGGAGGGCTGTGG + Intronic
946391564 2:219419501-219419523 ATGAGGCCCTGGGGGAGGTGGGG + Intronic
947109627 2:226705344-226705366 ATTTTCCCCTGGGAGGGATGGGG - Intergenic
947287530 2:228533146-228533168 AGGTGCCCCTGGGTGAACAGGGG + Intergenic
947536142 2:230941444-230941466 ATGTGGCCATGGGAGAGCCCAGG - Intronic
947594501 2:231402355-231402377 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
948371800 2:237494316-237494338 GTGTGCCCCAGGGAGAGCACAGG + Intronic
948423700 2:237875410-237875432 ATCTGCCTCTGGGAAGGCTGAGG - Intronic
948639317 2:239364507-239364529 AGGTTCCCCTGGGAGGGGTGGGG + Intronic
948894308 2:240921225-240921247 ACGGGCCCCTCAGAGAGCTGAGG - Intronic
949029842 2:241788617-241788639 AGGTGCCCCTGGGTGACCAGGGG + Intronic
1169948006 20:11010135-11010157 AGGTGCCCCCAGGAAAGCTGTGG - Intergenic
1170945437 20:20887443-20887465 CTGGGCCCCGTGGAGAGCTGTGG + Intergenic
1172027630 20:31959928-31959950 AAGTCCCTCTGGGAGAGCTGAGG - Intergenic
1173523395 20:43715274-43715296 ACCTGCCCCTGTGAGTGCTGTGG + Exonic
1173923791 20:46765581-46765603 AAGTGCCCTTGGGAGGCCTGGGG + Intergenic
1174282240 20:49447629-49447651 ATGTGAGGCTGAGAGAGCTGAGG - Intronic
1175165982 20:57045138-57045160 AAGGGCCCCTGGGGGCGCTGAGG - Intergenic
1175592184 20:60201996-60202018 ATGGGCTCCTTGGAGAGATGAGG + Intergenic
1175771550 20:61627646-61627668 TTGTGTGCCTGGTAGAGCTGAGG + Intronic
1176085636 20:63294314-63294336 AGGTGCCACTCGGAGAGGTGGGG - Intronic
1180500772 22:15927138-15927160 ATGTGCCCCTGGGTGACAAGGGG + Intergenic
1181168446 22:20995380-20995402 ACAAGCCCCAGGGAGAGCTGGGG - Intronic
1182109440 22:27712424-27712446 ATGTGCCCTTCCAAGAGCTGGGG - Intergenic
1182262697 22:29086539-29086561 ATGTGGCCCTGGGAAGGCAGGGG - Intronic
1184452131 22:44589460-44589482 ATGTGCCCCGGGAAGAGATCTGG - Intergenic
1184652891 22:45927182-45927204 ATGTGCCAGGGGCAGAGCTGGGG + Intronic
1184822315 22:46918481-46918503 GTGTGCCCCGGGGAGAGGTATGG + Intronic
1184924275 22:47626238-47626260 ATTTGCCACCGGGAGAGCTTGGG - Intergenic
1185337030 22:50275323-50275345 TTGGGCCCCTGGGGGATCTGAGG - Exonic
950015539 3:9752258-9752280 ATGTGCCCAAGTGAGAGTTGGGG - Intronic
950609722 3:14118282-14118304 ACGTGGCCCTGTGAAAGCTGCGG + Intronic
952916577 3:38250002-38250024 ATTTACTCCTGGGAGAGGTGAGG + Exonic
954441533 3:50524907-50524929 AGGAGGCCCTGGGAGGGCTGAGG + Intergenic
954974422 3:54679461-54679483 ATCAATCCCTGGGAGAGCTGGGG + Intronic
957044891 3:75365864-75365886 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
957076683 3:75608060-75608082 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
958503714 3:94946531-94946553 ATGAGCCCCTGGGGGAGAGGTGG - Intergenic
959418385 3:106104395-106104417 ATTTTCCCCTGGTGGAGCTGGGG - Intergenic
961271779 3:125694904-125694926 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
961274612 3:125717129-125717151 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
961277534 3:125739761-125739783 AGATGCCCCTGAGAGAGCAGCGG + Intergenic
961302976 3:125933992-125934014 GTGGGCCCCTGGGTAAGCTGGGG - Intronic
961885092 3:130091783-130091805 GTGTGCCCCTGGGTAAGCTGGGG + Intronic
961893321 3:130148077-130148099 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
962829656 3:139128877-139128899 ATCTCTGCCTGGGAGAGCTGGGG + Intronic
966918423 3:184597398-184597420 TTCTGCCCCTGGGAGAGGAGTGG - Intronic
968930594 4:3576643-3576665 TTGGGACCCTGGGTGAGCTGAGG + Intergenic
968989166 4:3897104-3897126 AAATGCCCCTGAGAGAGCAGGGG - Intergenic
968994284 4:3935982-3936004 GTGTGCCCCTGTGTAAGCTGGGG + Intergenic
969024840 4:4164748-4164770 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
969025737 4:4170693-4170715 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
969377024 4:6769548-6769570 GTGGGCCCCTGAGACAGCTGGGG - Intergenic
969728977 4:8942415-8942437 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969733719 4:8973058-8973080 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969785151 4:9451949-9451971 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969793310 4:9507118-9507140 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969819651 4:9710254-9710276 GTGTGCCCCTGGGTAAGCTGGGG - Intergenic
969875570 4:10133481-10133503 GTCTTGCCCTGGGAGAGCTGGGG + Intergenic
971424294 4:26501173-26501195 AATTCCCCCTGGGAGAGGTGAGG - Intergenic
973640950 4:52902107-52902129 AAGTGCTCCTGGGAGAGTTGGGG + Intronic
976208251 4:82642035-82642057 ATGTGCCCTAGAGAGAGATGGGG + Intronic
981604514 4:146527505-146527527 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
982151168 4:152459070-152459092 ATGGCCCCCTAGGAGAGGTGAGG + Intronic
982287376 4:153749107-153749129 ATGAGCCCCAGGAAGACCTGGGG + Intronic
985791046 5:1926865-1926887 ATGCTCCTCTGGGAGAACTGGGG - Intergenic
986003731 5:3650307-3650329 AGATGCCCCTGGAGGAGCTGAGG - Intergenic
986372970 5:7099027-7099049 AGCTGCTGCTGGGAGAGCTGGGG + Intergenic
986721183 5:10562986-10563008 ACGTGCCGCTGGGCAAGCTGAGG - Intergenic
988260711 5:28883099-28883121 ATGTGCTACTGGGAGACTTGAGG + Intergenic
990981076 5:61602851-61602873 TTCTGCCCCTGGGAGGTCTGAGG + Intergenic
991429354 5:66528209-66528231 ATGGTCCTCTGGGAGAGATGGGG + Intergenic
992998954 5:82360798-82360820 ATGAGGCTTTGGGAGAGCTGTGG + Intronic
993736468 5:91482593-91482615 ATGGGCCACTGTGAGAGCTCTGG - Intergenic
996366247 5:122704030-122704052 ATGGGCCATTGGGAGAGATGTGG - Intergenic
999392009 5:151199993-151200015 CTGTACCCCTGGCAGTGCTGAGG + Intronic
999705890 5:154272204-154272226 CTGTGCCCCTGGGATAAGTGAGG - Intronic
1001677932 5:173534004-173534026 ATGTGCACATCGGAGAGCTTTGG + Intergenic
1003092418 6:3115206-3115228 ATGTGTCACTGGGACAGATGCGG + Intergenic
1003760181 6:9171211-9171233 CTGTGCTCCTGGGAGAACAGGGG + Intergenic
1004342324 6:14818625-14818647 ATGTGCCTCTGGGAGGGCAAGGG - Intergenic
1005905894 6:30261198-30261220 ATGTGCCTTTGGGGGATCTGAGG - Intergenic
1006884203 6:37366912-37366934 ATGTGCAGCTGGGATAGCTATGG - Intronic
1007172435 6:39873223-39873245 ATGTGGACCTGGGAGAGAAGAGG - Exonic
1007208609 6:40172931-40172953 TTGTGCCCCTGGGAGAGAGGAGG + Intergenic
1010444332 6:75934039-75934061 ATGAGCCCCTTGGAGTCCTGTGG - Intronic
1012183847 6:96189209-96189231 ATCTGCTCCAGGGAGAGGTGAGG + Intronic
1012989548 6:105911296-105911318 GTGTGCCTCTAGGAGAGCTGGGG - Intergenic
1013415039 6:109917469-109917491 ATTTGCCCCTGCTCGAGCTGAGG - Intergenic
1014535596 6:122610250-122610272 ACGTGCCCCGGGGAGTGATGCGG + Intronic
1014949792 6:127541464-127541486 AGGTGAGCCTGGGAAAGCTGTGG + Intronic
1017341370 6:153326854-153326876 ATGTGCACCTGTGACAGCTTTGG + Intergenic
1018736132 6:166688397-166688419 ATGTGCCCCTGGCAAGGCCGGGG - Intronic
1019281192 7:201080-201102 ATGTGACACCGGGAGAGCTCAGG - Intronic
1019430431 7:996562-996584 ATGGGCCCCGGGGAGGGCTGAGG - Intergenic
1019576361 7:1739563-1739585 AAGACCCCCTGGGAGAGCTGGGG + Intronic
1019760913 7:2811993-2812015 CACTGCCCCTGGGAAAGCTGTGG - Intronic
1020307550 7:6846389-6846411 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1020312011 7:6875208-6875230 ACATGCCCCTGAGAGAGCAGCGG - Intergenic
1020318565 7:6924347-6924369 GTGTGCCCCTGGGTAAGCTGCGG + Intergenic
1021126558 7:16857103-16857125 ATGTGCTACTGGGGAAGCTGAGG - Intergenic
1021153200 7:17177003-17177025 ACGTGCTCCTGGGTGAGCAGAGG - Intergenic
1023045207 7:36204606-36204628 AGTTGCCCCTGGGACAGATGAGG + Intronic
1023347709 7:39288352-39288374 TTATGCCCCTGTGACAGCTGAGG - Intronic
1023941141 7:44769034-44769056 ATGAGCCCCTGGCTGGGCTGGGG - Exonic
1023983928 7:45084585-45084607 ATGCCCTCCTGGGAGGGCTGAGG + Exonic
1025018707 7:55464041-55464063 GTGTACCCTTGAGAGAGCTGAGG - Intronic
1025024375 7:55504436-55504458 ATGAGCCTCTGGGGGAGCAGAGG + Intronic
1025715703 7:63953495-63953517 ATGTCTCCCCAGGAGAGCTGGGG + Intergenic
1026592202 7:71706691-71706713 AAGTGCCCTTGAGAGAGATGTGG - Intronic
1026913407 7:74105964-74105986 ATGTGCCCCTGGACGAGGTACGG + Exonic
1027838619 7:83278878-83278900 ATCTGCTGCTGGGAGAGTTGAGG - Intergenic
1030619430 7:111772920-111772942 AGGTGCCCCTGGGAAAGCCTGGG + Intronic
1030968463 7:116023754-116023776 ATTTTTCCCTGGGAGTGCTGTGG - Intronic
1033024355 7:137758228-137758250 ATGAGCCCCTGGGTGAGCTATGG + Intronic
1033048969 7:137987032-137987054 TGGAGCCGCTGGGAGAGCTGGGG - Intronic
1033606138 7:142929604-142929626 CTGTGTCCCTGAGAGAACTGGGG - Intronic
1034276894 7:149827795-149827817 AGGTGGCCCCGGGGGAGCTGGGG + Intergenic
1034556429 7:151853087-151853109 CTGTGTCCCTCGGAGAGCTCGGG + Intronic
1035818260 8:2563443-2563465 ATTTTACCCTGGGAAAGCTGGGG - Intergenic
1036239349 8:7069158-7069180 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036262538 8:7251967-7251989 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1036304049 8:7587591-7587613 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036314577 8:7710506-7710528 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1036354904 8:8035583-8035605 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036381854 8:8240845-8240867 GTGTGCCCCTGGGTAAGCTGGGG - Intergenic
1036615427 8:10383939-10383961 CTGAGCCCCTGGGAAAGCAGTGG - Intronic
1036817444 8:11912767-11912789 AAATGCCCCTGAGAGAGCAGTGG - Intergenic
1036820409 8:11935347-11935369 AAATGCCCCTGAGAGAGCAGTGG - Intergenic
1037815709 8:22110543-22110565 CTGTGCTCCTGGGTGAGCTGTGG + Intergenic
1038217366 8:25574586-25574608 TTGAGCCCATCGGAGAGCTGAGG + Intergenic
1040868508 8:52075973-52075995 ATGTGTCCCTAGGATGGCTGTGG + Intergenic
1041496027 8:58486271-58486293 AGGTGTCCCTGGGAGTGCTTTGG - Intergenic
1041924223 8:63219867-63219889 TTTTTCCCCTGGGAGAGTTGGGG - Intergenic
1043005269 8:74810617-74810639 ATGTGGCCCTGTGACAGCTATGG - Intronic
1043677342 8:82973785-82973807 AGGTGCCCCTGGGTGACCAGGGG - Intergenic
1043948548 8:86281921-86281943 AGGTGCCCCTGGGTGACCAGGGG - Intronic
1047180673 8:122584855-122584877 ATGTTGCCCTAGGAGAGCAGGGG + Intergenic
1049178372 8:141207685-141207707 ACGTGCCCCTGGCAGCACTGTGG + Intronic
1049315460 8:141964646-141964668 AGGTGCAGCTGGGAGAGATGAGG + Intergenic
1049354314 8:142180040-142180062 ATGGGCACGTGGGAGACCTGGGG + Intergenic
1049391989 8:142376463-142376485 ATGGACCCCTGAGAGAGCTCCGG + Intronic
1049770783 8:144380065-144380087 CTGTGTCCCTGGGACAGATGCGG + Intronic
1049802752 8:144525780-144525802 ATGGGGCCCTGGGAAAGCTGGGG + Exonic
1051699856 9:19810192-19810214 AGGTGCTCCTCGGGGAGCTGGGG - Intergenic
1054459515 9:65455271-65455293 TTGGGACCCTGGGTGAGCTGAGG - Intergenic
1055955147 9:81766287-81766309 ATGTGACAGTGGGAGATCTGGGG + Intergenic
1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1056917678 9:90759201-90759223 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1057929206 9:99179089-99179111 CTCTGCCCCTGGGACAGTTGGGG + Intergenic
1059268860 9:113060284-113060306 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1059269996 9:113065733-113065755 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1059271130 9:113071181-113071203 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1059272263 9:113076627-113076649 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1059273398 9:113082069-113082091 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1059274534 9:113087515-113087537 ACGTGGCCCTGGGCGAGCTTCGG - Intergenic
1060324796 9:122603562-122603584 ATGTACCCCTGAGAGAGGTTTGG + Intergenic
1060344822 9:122806828-122806850 ATGTGTCAATGGGACAGCTGGGG - Intronic
1062060254 9:134491628-134491650 ATTGGCTCCTGGGACAGCTGGGG + Intergenic
1185644826 X:1609267-1609289 ATGTTCCCCTGGGAGAACGGAGG + Intergenic
1186168392 X:6851707-6851729 CAGTGCCCATGGGATAGCTGTGG - Intergenic
1186953167 X:14650708-14650730 TTGTGCACCTGGGAAAGGTGTGG - Intronic
1188462671 X:30446543-30446565 ATGTGTCCATGGGTGGGCTGGGG - Intergenic
1190076609 X:47321756-47321778 ATGTTCCCATGGGAGATCTGAGG + Intergenic
1192142096 X:68654572-68654594 ATGTGTGCCTGGGCGAGCTCAGG - Intronic
1193504527 X:82325695-82325717 ATGTGCTCCTGAGTGAACTGTGG - Intergenic
1194400053 X:93431311-93431333 AAATGCCCCTGAGAGAGCAGTGG + Intergenic
1195940829 X:110166569-110166591 AGGGGCCCCTGGGAGGCCTGTGG + Intronic
1198315790 X:135464824-135464846 ATGGGCCCCTGGGACACCGGAGG - Intergenic
1199044045 X:143147819-143147841 CTGTGCACCTGGAAAAGCTGCGG + Intergenic
1200141082 X:153903364-153903386 ATGTGCACCTGTGTGTGCTGCGG + Intronic
1200184756 X:154175176-154175198 ATGTGCTCCTAGCTGAGCTGGGG - Intergenic
1200190409 X:154212314-154212336 ATGTGCTCCTAGCTGAGCTGGGG - Intergenic
1200196160 X:154250116-154250138 ATGTGCTCCTAGCTGAGCTGGGG - Intergenic
1200201815 X:154287234-154287256 ATGTGCTCCTAGCTGAGCTGGGG - Intronic
1200679605 Y:6194564-6194586 CTGTGCACCTGGAAAAGCTGCGG - Intergenic
1200947874 Y:8864384-8864406 AAATGCCCCTGAGAGAGCAGTGG + Intergenic