ID: 1113428179

View in Genome Browser
Species Human (GRCh38)
Location 13:110227647-110227669
Sequence ATTGTATATTTGGGAATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 271}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113428179_1113428184 -9 Left 1113428179 13:110227647-110227669 CCCTTGATTCCCAAATATACAAT 0: 1
1: 0
2: 1
3: 29
4: 271
Right 1113428184 13:110227661-110227683 ATATACAATTGCCAACTTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 124
1113428179_1113428188 26 Left 1113428179 13:110227647-110227669 CCCTTGATTCCCAAATATACAAT 0: 1
1: 0
2: 1
3: 29
4: 271
Right 1113428188 13:110227696-110227718 CATGGGAATTCTAAACCTACAGG 0: 1
1: 0
2: 1
3: 7
4: 74
1113428179_1113428187 9 Left 1113428179 13:110227647-110227669 CCCTTGATTCCCAAATATACAAT 0: 1
1: 0
2: 1
3: 29
4: 271
Right 1113428187 13:110227679-110227701 GGTGGAAACTGAGCTCTCATGGG 0: 1
1: 0
2: 0
3: 15
4: 155
1113428179_1113428186 8 Left 1113428179 13:110227647-110227669 CCCTTGATTCCCAAATATACAAT 0: 1
1: 0
2: 1
3: 29
4: 271
Right 1113428186 13:110227678-110227700 TGGTGGAAACTGAGCTCTCATGG 0: 1
1: 0
2: 0
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113428179 Original CRISPR ATTGTATATTTGGGAATCAA GGG (reversed) Intronic
902098934 1:13968872-13968894 CTTGTAGATTTGGGAGTCATCGG - Intergenic
902656678 1:17873833-17873855 ATTCTCTATTTGGGAGACAAGGG + Intergenic
903170459 1:21549275-21549297 AGTATAAATTTGGGAATCATAGG - Intronic
903297604 1:22354847-22354869 ATTTTATAACTGGGAATTAAAGG + Intergenic
904846985 1:33427471-33427493 TTTGTATGTTTGGCAATGAAAGG - Intronic
906006139 1:42472525-42472547 ATTGCATATTTAGAAATAAAAGG - Intronic
906395669 1:45461950-45461972 ATTGTATATTTTAGAATAACTGG - Intronic
907990163 1:59573365-59573387 ATTGAATATTTTGGAGTAAAAGG + Intronic
908569985 1:65399567-65399589 ATTGTATACTTGGAAATTATTGG - Intronic
909368891 1:74861360-74861382 GGTATATATTTGGGAATCATTGG + Intergenic
910019558 1:82570429-82570451 GTTATATATTTGGGAATCATGGG - Intergenic
911601554 1:99853489-99853511 ATTGTGTAATTGGAAATCAAAGG - Intronic
912183292 1:107244488-107244510 AGTGTCTATTAGGGAATAAAAGG - Intronic
913198027 1:116474205-116474227 ATACTATCTTTGGGAATCACTGG - Intergenic
914444912 1:147741781-147741803 AAAGTATATTTGGGCAACAAAGG + Intergenic
916389420 1:164314876-164314898 ATTGCTTATTTGGGAAATAAAGG + Intergenic
917075759 1:171202929-171202951 AATGTACATTTTGGAAACAAGGG + Intronic
917636082 1:176938050-176938072 ATTTTATCTTAGGCAATCAAAGG + Intronic
917828741 1:178853891-178853913 ATTGTATATATGATAAACAATGG - Intronic
918690081 1:187468728-187468750 ATTTTATATTTAGGGATCATAGG + Intergenic
919277317 1:195438291-195438313 ATTGTGTATTTGCTAATCTAGGG - Intergenic
920598704 1:207300528-207300550 ATTATATATTTTTTAATCAAAGG + Intergenic
920760446 1:208778998-208779020 ATTGTGTAATTAGGAATAAATGG - Intergenic
923448316 1:234093239-234093261 AATGTATATTTGAGAACAAAAGG + Intronic
1063239333 10:4152136-4152158 TTTGTATATTTTGGATTCCAGGG + Intergenic
1064878962 10:20028479-20028501 GTACTATATTTGGGAATCAATGG + Intronic
1065272788 10:24053147-24053169 ATTGTATATTTTGGAAACACGGG - Intronic
1067998280 10:51301277-51301299 TTGGTATGTTTGGGAGTCAAAGG + Intronic
1068860590 10:61844083-61844105 ATTGTATATTTGTAAAGTAATGG - Intergenic
1071084243 10:81849649-81849671 ATTTTACATTTGAGAAACAATGG - Intergenic
1073451077 10:103609671-103609693 ATTGTATATTTTTGCTTCAATGG + Intronic
1076105023 10:127814970-127814992 ATGGTATCTTTGGGATTCCATGG - Intergenic
1077743324 11:4872404-4872426 ACTGTAGATGTGGGAATTAAGGG + Intronic
1079946471 11:26748723-26748745 ATTGTATATTTGTATATCAAGGG + Intergenic
1080483096 11:32673556-32673578 GTTGTATATTTTGGACTCAAGGG - Intronic
1081538073 11:44009809-44009831 ATTGTGCATCTTGGAATCAAAGG + Intergenic
1084143000 11:67246261-67246283 ATTGTACATATATGAATCAAGGG - Intronic
1086911776 11:92480328-92480350 ACAGTATATTTTGGAGTCAAAGG + Intronic
1087681387 11:101221585-101221607 ATAGCATATTTGGGAGGCAATGG - Intergenic
1088496243 11:110434213-110434235 ATTGTATACTTACAAATCAAAGG - Intronic
1088932788 11:114368862-114368884 ATTGAAAATTTAGTAATCAATGG - Intergenic
1090796826 11:130142518-130142540 TATTTATATTTGGGGATCAAGGG - Intronic
1092417112 12:8298670-8298692 CTTGTATGTTTGGGAAGCTAAGG - Intergenic
1092657609 12:10703522-10703544 ATTCTATAGTTGGGGATTAAAGG - Intronic
1093673695 12:21908316-21908338 ATTGTTTATTTGGAAGTCAACGG + Intronic
1094131967 12:27084232-27084254 ATAGAATATTTTGGAAACAAAGG - Intergenic
1095480741 12:42632914-42632936 ATTGTGTATATGGAATTCAAAGG + Intergenic
1098198166 12:68024303-68024325 ATTGCAAATTAGGGAAGCAATGG - Intergenic
1099568617 12:84284570-84284592 AGTGTATATTTGGGGAGCAAGGG + Intergenic
1099624396 12:85050356-85050378 ATTGTAGATTTGGTTATCAACGG - Intronic
1100738577 12:97565631-97565653 ATTGTATATTTAGGAAAGCAGGG + Intergenic
1100834020 12:98548163-98548185 TTTGTGTATTTGGGAAACGAAGG + Intronic
1100942302 12:99737598-99737620 AATGTATTATTGGGAATAAAAGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105488988 13:20869020-20869042 GTGGTATATTTTGGAATAAAAGG - Intronic
1106381016 13:29239324-29239346 TTTGTACATTTGAGAAACAAAGG + Intronic
1107730802 13:43346370-43346392 CTTCTAGATTTGGGGATCAAAGG + Intronic
1108372652 13:49786202-49786224 AGTCTACATTTGGGAATGAAAGG - Intronic
1110227221 13:73132269-73132291 GTTATATATTTGGGAGTCATCGG - Intergenic
1111136449 13:84051370-84051392 ATGGTAATTATGGGAATCAAAGG - Intergenic
1111364638 13:87225949-87225971 AGTATATATTTGGGATTGAAAGG + Intergenic
1111422969 13:88041404-88041426 AATGTACATTTTGGAATAAAAGG + Intergenic
1111764196 13:92506750-92506772 AAAGTATATGTGTGAATCAAAGG - Intronic
1112459340 13:99589583-99589605 ATTGTGGATTTGGGAAAGAACGG - Intergenic
1113147484 13:107224172-107224194 ATTATATATTTGGAATTAAATGG + Intronic
1113428089 13:110226551-110226573 ATTGTATATCTGGGAGTCAAGGG - Intronic
1113428179 13:110227647-110227669 ATTGTATATTTGGGAATCAAGGG - Intronic
1114775978 14:25481916-25481938 AGTGAATCTTTGGGAATTAATGG + Intergenic
1115677409 14:35694380-35694402 TTTGTCTATTTGGGCAACAACGG + Intronic
1115961686 14:38841082-38841104 AATCTATGTTTGGGAATAAAGGG - Intergenic
1116258162 14:42584914-42584936 ATTATATAATTTGGAATCATTGG - Intergenic
1117156145 14:52943641-52943663 TTTAAATATTTAGGAATCAAAGG + Intronic
1117702704 14:58430236-58430258 ATTGTATAATTGAGAATAAATGG + Intronic
1117918524 14:60703707-60703729 ACTCTATATTTAGCAATCAATGG + Intergenic
1118065193 14:62183230-62183252 TAAGTATATTTAGGAATCAAAGG - Intergenic
1119104375 14:71910267-71910289 ATTCTGTCTTTGGGAAGCAAAGG - Intergenic
1119577005 14:75733742-75733764 ATTGCATGTTAGAGAATCAATGG + Intronic
1120725844 14:87940108-87940130 GTTGTAGATCTGGGAATGAAGGG - Intronic
1120805950 14:88750799-88750821 ATTTACTATTTGGGAACCAAAGG + Intronic
1121995573 14:98599889-98599911 ATTGTATATTTTATAATAAAAGG + Intergenic
1124429911 15:29597948-29597970 TTTGTATATTTTGGAAACACAGG - Intergenic
1124615651 15:31240055-31240077 ATTTTATATTTGGAATTCTAGGG + Intergenic
1128929998 15:71695832-71695854 ATTGTATAGATGGGAAGCAGAGG - Intronic
1131702897 15:94958816-94958838 AGTGTTTATCTGGGAATAAAAGG + Intergenic
1134802400 16:17097397-17097419 ATTGTATTTTGAGGAATAAAGGG + Intergenic
1137028338 16:35499881-35499903 ATTGTTTCTTTTGGAATCACTGG - Intergenic
1138464479 16:57178041-57178063 TTTCTTTATTTGGGGATCAAGGG - Intronic
1139134737 16:64188503-64188525 ATTTTATACTTGGGAAGAAATGG + Intergenic
1139200864 16:64975543-64975565 AGTGGATATTTGGGCATCTAGGG + Intronic
1144334071 17:14253576-14253598 ATTGAATCTTTGGAAAGCAAAGG - Intergenic
1146575829 17:33990426-33990448 ATTGTACATTTGGAAAGCAAAGG + Intronic
1147343255 17:39768207-39768229 ATTGTATATTTAGGCATTAAGGG + Intronic
1148526697 17:48345328-48345350 CTTGAATATTTGGGAATGAGAGG - Intronic
1152061671 17:78080628-78080650 ATAATATATTTGATAATCAATGG + Intronic
1157075639 18:44464317-44464339 ATTTTATATTTGGTACTAAAAGG - Intergenic
1157111389 18:44823778-44823800 ATTTCTTATTTGTGAATCAAGGG - Intronic
1157670316 18:49522958-49522980 ATTTTATAGTTGAGAATAAAGGG + Intergenic
1157932208 18:51835446-51835468 AGGGTATATTTGGGAATGTATGG - Intergenic
1158064858 18:53394406-53394428 ATTATAGATTTGGGAGTAAATGG - Intronic
1158375920 18:56866822-56866844 ATTGTATATTTTGAAATAACTGG + Intronic
1158378057 18:56895177-56895199 ATTGTATATTTGGAAAACCAAGG + Intronic
1159619128 18:70617496-70617518 TTTGTGTATTTAGGATTCAAGGG + Intergenic
1160187839 18:76689079-76689101 CTGGCGTATTTGGGAATCAAAGG + Intergenic
1160363760 18:78306909-78306931 ATTGTAATTGTGAGAATCAATGG - Intergenic
1164407611 19:27966989-27967011 ATTGGTTATTTGGGAAATAATGG + Intergenic
1164790451 19:30973103-30973125 ATAGTTTATTTGGCAATCTAAGG + Intergenic
1165014353 19:32870024-32870046 CTTTTATCTTTGGGAATCAGAGG + Intergenic
1167757204 19:51420335-51420357 ATTGTAGATTTTGGTATCCAAGG + Intergenic
1167805206 19:51778217-51778239 AATGTACATTTTGGAATGAAGGG - Intronic
1168005266 19:53481788-53481810 AATTAAAATTTGGGAATCAATGG + Intronic
925589022 2:5491939-5491961 ATTGTAAATTTGTAAAACAATGG - Intergenic
926258067 2:11227468-11227490 ATTGTATATCTAGTAATAAATGG - Intronic
926936864 2:18094685-18094707 ATTGTATAAATGGAAATGAAGGG - Intronic
928073129 2:28237640-28237662 ACTGGATAATTGGGAAGCAATGG - Intronic
928641159 2:33301300-33301322 ATTGTTTATTTATGAAACAATGG - Intronic
928801791 2:35103084-35103106 ATACAATATTTGAGAATCAAAGG - Intergenic
929008344 2:37416988-37417010 ATTTTATTTTTGGGAAAAAATGG + Intergenic
931785294 2:65612532-65612554 AGTGTGTATTTGGGAATGGAAGG + Intergenic
932555142 2:72817102-72817124 ATTGTACATTTGGGTAAAAAGGG - Intronic
932824610 2:74927952-74927974 ATTCTCTATTTGGGAAACAATGG - Intergenic
933231023 2:79807270-79807292 GTTGTCTTTTTGGGAAACAAGGG - Intronic
933528244 2:83471747-83471769 ATTTTCTATTTGGGAGGCAATGG - Intergenic
933996624 2:87674761-87674783 ATTGTATCTTTAGGAATTAGTGG + Intergenic
935291869 2:101617907-101617929 ATAGTATCTCTGGGAATAAAAGG + Intergenic
936297227 2:111276149-111276171 ATTGTATCTTTAGGAATTAGTGG - Intergenic
936496735 2:113028997-113029019 ATGGTTTACCTGGGAATCAAGGG - Exonic
936504872 2:113098231-113098253 AGTGAATATCTGGGACTCAAGGG + Intergenic
937025994 2:118697680-118697702 ATTCTATTTTTGGGAAAAAATGG - Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
940210814 2:151254827-151254849 ATTATATATTTTAGAATAAATGG - Intronic
941513593 2:166444453-166444475 ACTGTATATTTGGGAAGGGAGGG + Intronic
943439439 2:187908603-187908625 TTGGTAAATTTGGGAATCAAAGG + Intergenic
944083965 2:195822381-195822403 AATGTTTATTTGAGAATAAATGG - Intronic
944462845 2:199969713-199969735 ATTGAATATCTGGGTATCATTGG + Intronic
945344341 2:208695180-208695202 ATTATATATTTGTGATTGAAAGG - Intronic
945774319 2:214085542-214085564 ATTTTATATTTGGGAATTTGAGG - Intronic
1169670310 20:8092627-8092649 ATTGTACATTTAGGAAAGAATGG + Intergenic
1169988323 20:11471686-11471708 AATATAAATTTGGGAATCTAGGG - Intergenic
1170232930 20:14070278-14070300 ACTATATATTTGAGAATAAATGG + Intronic
1170507481 20:17042480-17042502 ATTTAATATGTGAGAATCAAAGG - Intergenic
1173328310 20:42053408-42053430 ACTGTATATTTGGGAACCTCTGG + Intergenic
1174877086 20:54238585-54238607 ATTGTATCTTTGGAGATCAAAGG + Intergenic
1176226556 20:64003276-64003298 AGTGTATTTTATGGAATCAAGGG + Intronic
1176893167 21:14343850-14343872 ATTGAATATTTGAGAAAAAATGG + Intergenic
1178204113 21:30443286-30443308 ATTGTGTATGTTTGAATCAAAGG - Intergenic
1181337252 22:22146976-22146998 ATAGTATATTTAAGATTCAAGGG - Intergenic
1181560078 22:23694905-23694927 AGGGTAAATTTGGGAATCAGGGG - Intronic
1181652365 22:24267080-24267102 ATTGTCTATTTAGAAATAAATGG + Intergenic
1182292357 22:29290749-29290771 ATTGTATATTCAGGTATTAAAGG + Intronic
949113756 3:294640-294662 ATTCTATATTTGGAAAAAAAAGG - Intronic
949908197 3:8877099-8877121 ATTTTGTATTTTGGAATCAAAGG + Exonic
951098276 3:18656811-18656833 ATTTCATATCTGGGAATCAGTGG + Intergenic
951398260 3:22198259-22198281 ATTGTATATTTAGAAATAAGAGG + Intronic
952035655 3:29197276-29197298 ATTTAATATTTGGGCATCATTGG - Intergenic
953066053 3:39472201-39472223 ATTTTATATTTGTTAATCTAAGG - Intronic
953375471 3:42424569-42424591 ATTTGATATTTGGGAAGGAATGG + Intergenic
955495140 3:59523567-59523589 GTTGTATATTTCAGAATCACTGG - Intergenic
955782894 3:62505245-62505267 AGTGGATATTGGAGAATCAAGGG - Intronic
956379550 3:68651259-68651281 ATTTTATAGTTGGGAAACACAGG + Intergenic
956759319 3:72424697-72424719 TTTGTATCTTTGAAAATCAATGG - Intronic
957022783 3:75143072-75143094 TATGTAAATTTAGGAATCAATGG + Intergenic
957314623 3:78561535-78561557 ATTGTATAGTAGGGAAACTATGG - Intergenic
961257592 3:125570239-125570261 ATTGTATCTTTGGGAGGCCAGGG + Intronic
962445373 3:135459169-135459191 TTTGTATGTTTGGGAATGAGTGG - Intergenic
963266811 3:143248018-143248040 ATTATATCTTTGGTAATGAAGGG + Intergenic
963310732 3:143707537-143707559 ACTTTATATTTGGGAAACAAAGG - Intronic
964539793 3:157767319-157767341 ATTCTATATTAGGGGATCAGGGG + Intergenic
964895927 3:161595223-161595245 ATTGTATAATTGGCAATTATAGG - Intergenic
966245282 3:177801389-177801411 AATGTTTATTTTAGAATCAAGGG - Intergenic
966472655 3:180308851-180308873 GTGGGCTATTTGGGAATCAATGG + Intergenic
969083928 4:4641356-4641378 TTTGTATCTTTGGGCTTCAAAGG + Intergenic
969154479 4:5198418-5198440 TTAGTATTATTGGGAATCAAAGG - Intronic
969241078 4:5898053-5898075 ATTGTGCATTTGGGATTCAGCGG + Intronic
971199414 4:24498488-24498510 ATTCAATATGTGGGAATCCATGG - Intergenic
973945920 4:55955677-55955699 AATGTAGATTTGGGAAGCAGAGG + Intronic
974245323 4:59307831-59307853 ATTGTCTCTTGGGGAATCAAAGG - Intergenic
975087133 4:70355654-70355676 GATGGACATTTGGGAATCAATGG - Intergenic
976488025 4:85632064-85632086 ATAATATATATGGAAATCAAGGG - Intronic
976708973 4:88048763-88048785 ATTGAGAATTTGGGGATCAAGGG - Intronic
977254068 4:94720838-94720860 ATTGTATATTTCAGAATAACTGG + Intergenic
978298489 4:107237382-107237404 ATTGGACATTGGGGACTCAAGGG - Intronic
979903977 4:126260437-126260459 ATTGTATATTTTGGTATAATTGG + Intergenic
980471145 4:133253497-133253519 AGTGTATATTTTGGATTCATTGG - Intergenic
980532788 4:134075866-134075888 AATATATATTTTGGAATCAATGG - Intergenic
981985304 4:150847376-150847398 ATTTTATATTTAATAATCAATGG - Intronic
983044048 4:162964672-162964694 AGAGAATATTTGAGAATCAAAGG - Intergenic
983270212 4:165552203-165552225 ATAGTATCTATGGGAATCAAGGG + Intergenic
983384380 4:167039742-167039764 ATTTAATATTTCGGAATAAAAGG + Intronic
985311154 4:188601088-188601110 AGTGTATATTTGGGAAAAAAGGG - Intergenic
986218576 5:5745219-5745241 TTGGTATTTTTGGGATTCAAAGG + Intergenic
986634496 5:9807743-9807765 ATTGGACTTTTGGGACTCAAGGG + Intergenic
987059675 5:14230443-14230465 ATTTTATATTTGGAAATCTGTGG - Intronic
987288004 5:16478660-16478682 ATTGTATATTTGAGAAAAGAAGG + Intronic
987428442 5:17800945-17800967 AATGTTTATTTGAGAAACAAAGG + Intergenic
987960252 5:24797545-24797567 ATTATATCTTTGGTATTCAATGG + Intergenic
988460248 5:31429146-31429168 ATTTTATATTTTAGAATCATTGG - Intronic
988554860 5:32227656-32227678 ATAGCATATTTGGGAGGCAATGG + Exonic
988653434 5:33179831-33179853 ATTTTATATGTGAGAATTAAAGG - Intergenic
989227170 5:39042537-39042559 ATTATATATTGAGGAATAAAAGG - Intronic
989401883 5:41016649-41016671 TTTGTATTTTTGGGAGACAATGG + Intronic
990009531 5:50979808-50979830 ATTATTTATTTGGCAATTAAGGG + Intergenic
990488128 5:56278996-56279018 ATGGAATCTTTGGGAATGAATGG + Intergenic
990831745 5:59966972-59966994 ATTATATATTTGGGGCTAAATGG - Intronic
990976345 5:61564861-61564883 ATTGGACCTTTGGGAATGAAGGG - Intergenic
991269419 5:64762153-64762175 ATTGTCTATTTTGGAATTTAGGG + Intronic
993970160 5:94409715-94409737 ATTGTATATCTGACATTCAAAGG + Intronic
994016565 5:94973375-94973397 ATTGTATACTAGGGAAGCCATGG + Intronic
995066172 5:107865449-107865471 ATTGCATTTTGGGAAATCAAAGG - Intronic
995295788 5:110520134-110520156 ATTGTATATTTCAAAATAAAAGG + Intronic
995305840 5:110648526-110648548 ATGGTATGTTTGTGAATAAAGGG + Intronic
997018770 5:129971074-129971096 ATAGTATATTTGGAATTCAAAGG + Intronic
1000165808 5:158647619-158647641 ATTGTTTATTTGAGTTTCAAAGG + Intergenic
1000877509 5:166659123-166659145 ATTTCATATGTGGTAATCAATGG - Intergenic
1003904688 6:10688611-10688633 ATTTTATACTTGGGCATCCAAGG - Intronic
1004137926 6:12986367-12986389 ATTGTCTATTTAGTAATGAAAGG - Intronic
1004488980 6:16095868-16095890 AATGTACATTTTGAAATCAAAGG - Intergenic
1004889882 6:20090280-20090302 ATTGTTGGTTTGGGAAACAAAGG + Intergenic
1004925793 6:20413900-20413922 GTTAAATATTTGGGAGTCAAAGG - Intronic
1008032841 6:46716453-46716475 ATTCTTTATTTGGGATCCAAAGG + Exonic
1008588609 6:52970872-52970894 TTGTTAAATTTGGGAATCAAAGG - Intergenic
1009195887 6:60683914-60683936 AGTGGATATTTGGCAATGAATGG + Intergenic
1010109263 6:72205506-72205528 ATTGTATATTTCACAATTAATGG + Intronic
1010470809 6:76226255-76226277 ATTGTACATGTGTGAATTAATGG + Intergenic
1010498324 6:76563514-76563536 ATTGCATATTTGGGAAATCAGGG + Intergenic
1011500266 6:87980748-87980770 ATTTTATATTTGATTATCAATGG - Intergenic
1011934715 6:92761466-92761488 ATTCTATATTTTGAAAACAATGG - Intergenic
1012230654 6:96757387-96757409 ATTGTATACTTGAAAATCACTGG + Intergenic
1012458505 6:99433248-99433270 ATTTTATATTTGGAAAAAAACGG + Exonic
1013157075 6:107502930-107502952 TTTGTATATTTGGTAGACAAGGG + Intronic
1013293749 6:108740531-108740553 GTTGTATATGTGGCAATAAAAGG + Intergenic
1013399574 6:109779371-109779393 AGTTTATATGTGGGAATAAAAGG + Intronic
1014990726 6:128072674-128072696 TTAGTATATTTGGGTAACAATGG - Intronic
1015413876 6:132926448-132926470 ATTGTATATTTGAAATTAAAGGG - Intergenic
1019839848 7:3430213-3430235 ATTCTAAATTTGGTAATAAAAGG + Intronic
1020820705 7:12963772-12963794 ATTTTATATTATGGAGTCAAAGG - Intergenic
1021617479 7:22517747-22517769 ATTGTATATTTGGGACTAGGTGG - Intronic
1021754434 7:23837539-23837561 ACTGTATATTTGGCAAACACTGG - Intergenic
1022753973 7:33265040-33265062 ATTGTAAATTGGGGAATAGATGG + Intronic
1022826995 7:34025262-34025284 AATGTATATTTAAAAATCAAAGG - Intronic
1022855892 7:34313893-34313915 ATTGAATATTTGCAAAACAAGGG + Intergenic
1022927065 7:35067161-35067183 ATTGTATATTTGGGACTAGGTGG - Intergenic
1023317615 7:38956580-38956602 TTTGTATGTTTGGGAAACACTGG - Intergenic
1025577147 7:62660938-62660960 ATGGTATATTTGGGAGTGCATGG - Intergenic
1026275988 7:68876969-68876991 ATTGTATTGATGGAAATCAATGG - Intergenic
1027492725 7:78850037-78850059 ATTGTATAGTTGGGAAAACAAGG - Intronic
1027745718 7:82071446-82071468 ATTATATATTTGGGCAGCAATGG + Intronic
1028014608 7:85691196-85691218 ATTTTATATTTGGTAATCCCAGG - Intergenic
1028375198 7:90138363-90138385 ATTGTATATTTGGGACTAGGTGG + Intergenic
1028924891 7:96347107-96347129 TTTTTATCTTTGGGAAACAAAGG + Intergenic
1030675845 7:112384640-112384662 TTTGTATATTTTAGAATCATGGG + Intergenic
1031633046 7:124067037-124067059 ATTGTTTATCTGGAAAACAATGG + Intergenic
1031670206 7:124533581-124533603 ATTGTATATTGAGGAATGCATGG + Intergenic
1032143802 7:129359896-129359918 ATTGTTTATTTGAGAAACACTGG + Intronic
1032743233 7:134760467-134760489 ATAAAATATTTTGGAATCAAGGG - Intronic
1033066369 7:138158827-138158849 ATAGTATTTTTGGTAATCATGGG + Intergenic
1033821212 7:145136181-145136203 ATTGAAGATTCGGGAATGAAAGG + Intergenic
1033939847 7:146639174-146639196 ATTATATATTTGAGACTAAAAGG + Intronic
1035403480 7:158583938-158583960 ATTGTTTATTTTTAAATCAAAGG - Intronic
1035821014 8:2591860-2591882 TTCTTATATTGGGGAATCAATGG - Intergenic
1036988284 8:13561955-13561977 ATTATATATTTGGAAAACACAGG + Intergenic
1036991071 8:13594748-13594770 ATTGTAAATATGGGTATTAAAGG - Intergenic
1037982667 8:23265671-23265693 ATTGTGTATGTGGTAATCCAAGG + Intergenic
1038645006 8:29353517-29353539 ATTGTATGTTTGTGAACCATTGG + Intergenic
1039645298 8:39276089-39276111 AGTTTATTTTTGGGAAACAAAGG + Intronic
1042232865 8:66576550-66576572 ATTATGTATTTTGGAATCATAGG - Intronic
1043152196 8:76731732-76731754 AATATATATTTTGGAATCAAAGG + Intronic
1044080847 8:87881401-87881423 AGTGTATATTTGGGGATATAAGG - Intergenic
1044124786 8:88445312-88445334 TATGTATATTTTTGAATCAAAGG + Intergenic
1044653677 8:94525022-94525044 ATTGTGTACTGGGAAATCAATGG - Intronic
1045056006 8:98369051-98369073 AGAGGATATTTGGCAATCAAGGG - Intergenic
1045396325 8:101764144-101764166 ACTATATATTTGGGAATCACTGG + Intronic
1045604520 8:103757157-103757179 ATTTTATATTTAAGAATCAAAGG - Intronic
1045756679 8:105551803-105551825 ATTGTATAGTTGGAGATGAAAGG - Intronic
1045869747 8:106911244-106911266 CTTATATATTTAGGAATGAATGG + Intergenic
1045898959 8:107252070-107252092 ATGGAATATTTGGAAATTAATGG + Intronic
1046256956 8:111712645-111712667 ATTGTATATATGGGAATGTATGG + Intergenic
1047287265 8:123498216-123498238 ATTCTATACTTGGGAATCCTTGG - Exonic
1050824101 9:9922290-9922312 ATAGTATACTTCGGATTCAAGGG - Intronic
1051395134 9:16612232-16612254 ATTGTTTATTTGTGAATGAAAGG - Intronic
1051418357 9:16867371-16867393 ATTGGATATTTGGGGATCGTAGG + Intronic
1052842674 9:33306444-33306466 AATGTGGATTTGGGGATCAATGG + Intronic
1054716627 9:68563474-68563496 ATTGTTTATTTAGGGAACAATGG + Intergenic
1054734024 9:68732420-68732442 TTGGCATATTTGGGATTCAAAGG + Intronic
1054957785 9:70933254-70933276 ATAGTAAATTTGGAAATCATTGG + Intronic
1055624724 9:78164434-78164456 AGTGCATATTTGGGAGGCAAGGG + Intergenic
1056004106 9:82248950-82248972 ATTTGGTATTTGGGAACCAAGGG + Intergenic
1056128550 9:83562034-83562056 ATTGTATATTTGGAGAATAAAGG + Intergenic
1058951614 9:109909197-109909219 ATTGTATATTTGGGGAACTTGGG + Intronic
1059070270 9:111128306-111128328 ATGGTATATTTGGAGATGAAAGG + Intergenic
1059808573 9:117830956-117830978 ATTGTCTTTTTAGGAATGAATGG + Intergenic
1060315038 9:122501806-122501828 GTCGTTTATTTGAGAATCAAAGG + Intergenic
1060449114 9:123720536-123720558 ATTGTATTTTGGTGAATGAAAGG - Intronic
1062301658 9:135876341-135876363 TGTATGTATTTGGGAATCAAGGG - Intronic
1188688716 X:33102382-33102404 ATTGGATTTCTGGGAATTAAAGG + Intronic
1188805726 X:34586980-34587002 AATGTTTATTTTGGTATCAAAGG + Intergenic
1188859176 X:35236525-35236547 TTTGTTTAATTGAGAATCAAAGG + Intergenic
1189010184 X:37039189-37039211 TTTTAATATTTGGGAATCATGGG - Intergenic
1189038398 X:37516518-37516540 TTTTAATATTTGGGAATCATGGG + Intronic
1190018566 X:46851152-46851174 ATTGTATATATGGGAGCCTATGG + Intronic
1196781595 X:119388546-119388568 AGTATATATTTGGGAGTCATCGG + Intergenic
1198979073 X:142374273-142374295 AGTATATATTTGGCAATCAGTGG + Intergenic
1199430281 X:147751916-147751938 ATTGAATATCAGTGAATCAAAGG + Intergenic