ID: 1113429730

View in Genome Browser
Species Human (GRCh38)
Location 13:110239698-110239720
Sequence CTGAATATGCAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113429721_1113429730 30 Left 1113429721 13:110239645-110239667 CCTTTAGTCATTTTGTTTTTACA 0: 1
1: 0
2: 6
3: 53
4: 612
Right 1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113429730 Original CRISPR CTGAATATGCAGAAGGTGGC AGG Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
901676202 1:10887201-10887223 CGGAAAATGCAGAAGTTAGCTGG - Intergenic
902309708 1:15572519-15572541 CTGAAAATACAGAAGTTAGCTGG - Exonic
905473494 1:38209814-38209836 CTGGGGATGCAGAAGCTGGCGGG + Intergenic
906065029 1:42974669-42974691 CTGATTCTACAGAAGGAGGCCGG + Intergenic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
917412939 1:174778888-174778910 ATAAAAATGCAGAAGGTGGCCGG - Intronic
917609418 1:176671429-176671451 CAAAATATCCAGAAGGTGGCTGG + Intronic
917679184 1:177348880-177348902 ATGAATCTGCACAAGGTAGCTGG + Intergenic
918068220 1:181116227-181116249 CTGAATATACAAAAGTTAGCTGG + Intergenic
918291073 1:183108385-183108407 CTGATTTTGCTGTAGGTGGCAGG + Exonic
919210359 1:194474942-194474964 ATGAAAATGCAGAAGGTGACTGG + Intergenic
919402528 1:197137640-197137662 CTGATAATGCAGAAGTTGGCTGG - Intronic
921729679 1:218563419-218563441 ATGAAAATGAAGAAGGTAGCTGG - Intergenic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
923868694 1:237967515-237967537 CAACATATGCCGAAGGTGGCTGG + Intergenic
923989208 1:239415973-239415995 CTGAATATACACATGGTAGCAGG + Intronic
924109422 1:240683446-240683468 CTGATTATGCTGTAGGTGGGAGG + Intergenic
1066192228 10:33066588-33066610 CTAAAGATGTAGAAAGTGGCTGG - Intergenic
1066283844 10:33944737-33944759 CTGAATATGTAAAAGATGGAAGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG + Intergenic
1069976179 10:72215235-72215257 CTGAAAATACAGAAAGTAGCCGG + Intronic
1070567590 10:77615424-77615446 CTGAGGCTGCAGAAGGTGGGTGG + Intronic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074922023 10:118024434-118024456 ATGGATACGTAGAAGGTGGCGGG - Intronic
1075395855 10:122126543-122126565 TTGCATATACAGAAGGTGGTTGG - Intronic
1075827621 10:125373188-125373210 CTAAAAATGCAAAAGTTGGCTGG + Intergenic
1075834635 10:125443202-125443224 CTGACTATGAAGAATGTGCCTGG - Intergenic
1075986248 10:126787954-126787976 CTAAATATTCAGAATGTTGCTGG - Intergenic
1076490758 10:130859725-130859747 ATGAAAATGCACAAGGAGGCCGG + Intergenic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1084952521 11:72674443-72674465 CTGATAATGCAGAAGGGGGAGGG + Exonic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1086466274 11:87056952-87056974 TTAAGTATGCAGAAGATGGCAGG + Intronic
1086545189 11:87959567-87959589 CTGAATTTGTATAAGGTAGCTGG + Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087630851 11:100648420-100648442 CTGATTATCCAGAATGTTGCAGG - Intergenic
1089737043 11:120556709-120556731 GTGTATATGCAGGAGGTGACAGG - Intronic
1089847480 11:121469842-121469864 CAGAATATGCATGAGGTGGGAGG + Intronic
1089903604 11:122013580-122013602 GTTAATCTGCAGAAGATGGCAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092838374 12:12514364-12514386 CTGCATCTGCAGAAGGTTTCAGG - Intronic
1095875030 12:47070880-47070902 CTGAAAATGCAGGAGATGGAAGG - Intergenic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097537740 12:60894717-60894739 CTGGATATGGATATGGTGGCAGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1101785038 12:107875111-107875133 CCTAATCTGCAGAAGGTAGCTGG + Intergenic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102285679 12:111654475-111654497 CTGAAAATGCAGAAACTGGTCGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105803306 13:23930377-23930399 CTGAATACGCAGGAAGTAGCTGG + Intergenic
1106437187 13:29733424-29733446 CTGAATAGGCAGAAGCTTGTTGG - Intergenic
1107018109 13:35724779-35724801 CTGAGTATGCACATGATGGCTGG + Intergenic
1108376503 13:49818977-49818999 CTAAATATAGAAAAGGTGGCTGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1116342594 14:43743938-43743960 CTGAATAACCTAAAGGTGGCAGG + Intergenic
1117673180 14:58128613-58128635 TGAAATATGCACAAGGTGGCAGG + Intronic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1120520185 14:85518497-85518519 CTGAATCAGAAGAAGGTTGCAGG + Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1123141799 14:106087197-106087219 CTGAACAGGCTGAAGATGGCCGG + Intergenic
1124887955 15:33704458-33704480 GTGTGTATGCAGGAGGTGGCTGG - Intronic
1127035921 15:54917647-54917669 CTGAAGATCCAGAAGGTTCCTGG - Intergenic
1127454006 15:59141634-59141656 CTGAAAATACAGACGGTAGCTGG + Intronic
1133187200 16:4108533-4108555 CTGAAAATGCAAAAATTGGCTGG - Intronic
1134313348 16:13096233-13096255 CTCAATACACAGAAGGTAGCTGG + Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135643060 16:24137648-24137670 ATGGATATGCAGAGGATGGCAGG - Intronic
1135938319 16:26799541-26799563 CTGAAAATGCAAAAGTTAGCTGG + Intergenic
1136021127 16:27440752-27440774 TTGAAAGTGAAGAAGGTGGCTGG + Intronic
1136339603 16:29633433-29633455 CTGAAAAGGCAGTGGGTGGCGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1138462506 16:57159351-57159373 CTGCAAATGCAGAAGTTGGCAGG - Intronic
1139625974 16:68188428-68188450 CTGCCAATTCAGAAGGTGGCGGG + Intronic
1139735854 16:68987528-68987550 CTAAAAATGCAAAAGTTGGCCGG - Intronic
1141263572 16:82475571-82475593 CTGAGGATGCAGAGGCTGGCAGG - Intergenic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1143119005 17:4595831-4595853 CTGAATATGCAAAGGTGGGCTGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1144959536 17:19037329-19037351 CTGGGTATGCAGAAGTTGCCTGG + Intronic
1144975623 17:19137195-19137217 CTGGGTATGCAGAAGTTGCCTGG - Intronic
1145839647 17:27983745-27983767 CTGCATATTGAGAAGGGGGCTGG + Intergenic
1146264666 17:31444449-31444471 CTGATTAAGCCAAAGGTGGCGGG + Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147680018 17:42236912-42236934 GTAAATAAGCAGAAGATGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1151218073 17:72591585-72591607 CTGAATAGGTGGGAGGTGGCAGG - Intergenic
1151394616 17:73814267-73814289 CTGAAGATGCAGCAGGTTTCCGG - Intergenic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1155836632 18:30593784-30593806 TTGTAAATGCAGAAGTTGGCTGG - Intergenic
1156692246 18:39722263-39722285 CTGATAATTCAGAAGGTGGTGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1162688479 19:12408735-12408757 ATCAAAATGCATAAGGTGGCTGG + Intronic
1163057338 19:14730349-14730371 CTGAAAATGAAGACAGTGGCCGG - Intronic
1164177839 19:22792755-22792777 CTGAAAATGCAAAAAGTAGCTGG + Intergenic
1164502965 19:28834712-28834734 CTGCCTATGCAGCAGGTGGCTGG - Intergenic
1165281983 19:34805570-34805592 CTGGAAATGGAGAAAGTGGCTGG - Intergenic
1166617555 19:44264234-44264256 CTGAATTTTTAAAAGGTGGCCGG - Intronic
1166890249 19:45987389-45987411 CTGCATCTGCTGAACGTGGCCGG + Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1168226195 19:54997067-54997089 CTAAATATACAGAAGTTAGCTGG - Intronic
926269017 2:11351060-11351082 CTGAAAATACAGAAATTGGCCGG + Intergenic
927023268 2:19039866-19039888 CTGAATATTCACAAGCTGGTAGG - Intergenic
927837901 2:26415768-26415790 CTAAAAATACAGAAGTTGGCTGG + Intronic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
928577780 2:32673521-32673543 CTAAAAACGCATAAGGTGGCCGG - Intronic
929309665 2:40407729-40407751 CTGAATATTCACAAAGTGCCAGG - Intronic
929585332 2:43110356-43110378 CTGAAGATGCAGAATTTTGCTGG + Intergenic
930077155 2:47415769-47415791 CTAAATCTGCAGTAAGTGGCTGG + Intronic
931393517 2:61865272-61865294 CTGAGTAAGAAAAAGGTGGCTGG + Intergenic
931968609 2:67561285-67561307 CTGACCTTGCAGAAGGAGGCAGG + Intergenic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
933595729 2:84281520-84281542 CTGAACACTCAGTAGGTGGCCGG + Intergenic
935013450 2:99157154-99157176 CTGCATGTGCAGAGTGTGGCAGG - Intronic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
935479281 2:103564263-103564285 CTGAAAATGCAAAAGTTAGCTGG + Intergenic
935597581 2:104891141-104891163 CTGAATATGAAGTAGGTGCTAGG - Intergenic
937118722 2:119427525-119427547 ATGAATGTGCATAAGGTGTCAGG - Intergenic
937202127 2:120210422-120210444 CTGAAAACAGAGAAGGTGGCTGG + Intergenic
938510901 2:131942307-131942329 CTGATTTTGTAGTAGGTGGCTGG + Intergenic
940502898 2:154516626-154516648 CTAAATATGAAGAAGGTGGGTGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942244364 2:173993337-173993359 CTAAATATGCAGAATTTGGTGGG + Intergenic
944853291 2:203742399-203742421 CTAAAAATGTAGAAGGTGGCTGG - Intergenic
945659230 2:212665159-212665181 ATGAATATGTAGAAGGTGTTTGG - Intergenic
946222665 2:218241849-218241871 CTGAATTTGGAAAGGGTGGCAGG - Intronic
948197512 2:236106633-236106655 ATGCATTTGGAGAAGGTGGCTGG + Intronic
1170399772 20:15968995-15969017 CTGATTCTACAGAAGGTGTCTGG + Intronic
1171305116 20:24098540-24098562 GTCAAAATGCAGAAGGAGGCCGG - Intergenic
1172377958 20:34461412-34461434 CAAAAAATGCAGAAGATGGCTGG + Intronic
1172381610 20:34497738-34497760 CTAAAAATACAGAAAGTGGCTGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1174032400 20:47640462-47640484 CTCAATAGGCAGCAGGTGGTTGG - Intronic
1174345363 20:49925168-49925190 CTAAAAATGCAAAAGTTGGCCGG + Intergenic
1174511046 20:51052837-51052859 CTAAATATGCAAAAGTTAGCTGG - Intergenic
1174619735 20:51864857-51864879 CTGAAAATACAGAAGTTAGCCGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1176009574 20:62885764-62885786 ATGAATATGTAAAATGTGGCAGG + Intronic
1178394432 21:32229304-32229326 CTGCATCTGCAGCAGGTGCCAGG + Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1181932742 22:26415763-26415785 CTAGAAATGCAGAAGGTGGGTGG - Intergenic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949144082 3:673954-673976 CTTAATATCCAAAATGTGGCAGG + Intergenic
950109823 3:10411910-10411932 CTGGAAATGCAGATGGTGGGTGG - Intronic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
953075251 3:39564148-39564170 CCCAGTATGCAGAAGGTAGCAGG - Intergenic
953778324 3:45842285-45842307 CTGCAGTTGCAGAAGGTAGCGGG + Intronic
956688777 3:71856928-71856950 CTGATTATGCAGATGATGGAAGG - Intergenic
956896395 3:73665037-73665059 GTGAAAAGACAGAAGGTGGCTGG - Intergenic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
961514805 3:127425844-127425866 CTCAAGATGCAGAAGGGGCCGGG + Intergenic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
964288745 3:155151922-155151944 CTGAAGATATAGAAGGTGGTTGG - Intronic
964916358 3:161846739-161846761 ATGAGTATGAAGAAGGTGTCAGG + Intergenic
966486442 3:180476313-180476335 CTGAAGATTATGAAGGTGGCTGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
970277065 4:14412603-14412625 CTAAAAATGCAGAAGTTAGCTGG + Intergenic
971790208 4:31160484-31160506 GTGAATATGCAGTGGGTGGAGGG + Intergenic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
974650439 4:64748148-64748170 GTGAATATGCATAAAGTGCCCGG - Intergenic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
983233393 4:165152125-165152147 CTGAATATTCAGAAAGCTGCTGG + Intronic
984427773 4:179609547-179609569 CTGAAAATACAGAAGTTAGCCGG + Intergenic
984652607 4:182286550-182286572 CTGTAGATGCAGAAGGTTGTGGG + Intronic
984764591 4:183390052-183390074 CTGAATCTGCAAGAGGGGGCAGG + Intergenic
987284918 5:16446575-16446597 CTAAATATACAGAAGTTAGCTGG + Intergenic
987415956 5:17662619-17662641 ATGTATATGTAGGAGGTGGCTGG + Intergenic
987951234 5:24679151-24679173 CTGAATATGAAAAAATTGGCTGG - Intergenic
989424079 5:41275521-41275543 CTGGGTATGCAGAAGTTTGCTGG + Intergenic
990971081 5:61506419-61506441 CTGAAAATGCAAAAGTTAGCTGG + Intronic
991367707 5:65886437-65886459 CTGAATATGCACTAGGTGCTGGG + Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
993576557 5:89609279-89609301 CTGACCATGAAGAAGGTAGCAGG - Intergenic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
995201564 5:109430427-109430449 CTAGAAATGCAGAAGGTGCCCGG + Intergenic
997200118 5:132004842-132004864 CAGAATATGCATGAGTTGGCTGG + Intronic
997867364 5:137476451-137476473 GTGAATATCTAGAAGGTGGAAGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
1000246131 5:159449872-159449894 TTGAATATTCAGAAGGGAGCTGG + Intergenic
1000758383 5:165189432-165189454 TTGTATATGTAGAACGTGGCTGG + Intergenic
1000784282 5:165524522-165524544 CTGAATATTCAGGATGTGCCAGG - Intergenic
1002173715 5:177389734-177389756 CGGAAGCTGCAGTAGGTGGCCGG - Intronic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1004194500 6:13490984-13491006 CTGAATATCTAGCAGGTGCCAGG - Intergenic
1004265512 6:14145424-14145446 CTGAAGCTGAAGGAGGTGGCTGG - Intergenic
1004538517 6:16526466-16526488 TAGAATATTCAGTAGGTGGCCGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007550316 6:42724439-42724461 ATGAATAGGCAGAACATGGCAGG - Intergenic
1007587090 6:42997840-42997862 CTAAAAATACAGAAGTTGGCTGG - Intronic
1007832628 6:44650416-44650438 CTGAATATACAGAAATTAGCCGG + Intergenic
1008916623 6:56794793-56794815 CTGATTTGGCAGAAGATGGCTGG - Intronic
1011443500 6:87412390-87412412 CTGAATATACTGCAGCTGGCAGG - Intronic
1012807685 6:103915784-103915806 CTGTATATTCAGAAGGGAGCTGG - Intergenic
1012947945 6:105487794-105487816 CTAAAAATGCAGAAGTTAGCTGG + Intergenic
1013939446 6:115644406-115644428 CTGGACATGCAAAAGGTGTCTGG + Intergenic
1015156357 6:130100913-130100935 CTGTATATGAAGAAAGTGACAGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017248531 6:152254544-152254566 AAGAATATGCAGAAAATGGCCGG - Intronic
1017450769 6:154552534-154552556 CTGAAAATACAGAAGTTAGCTGG - Intergenic
1018219726 6:161565987-161566009 CTGATGATGCAGAAGGGGGAAGG - Intronic
1019194030 6:170271004-170271026 ATGAAAGTGAAGAAGGTGGCCGG - Intergenic
1020128034 7:5544037-5544059 CTGAAAATGCAAAAAGTAGCTGG + Intronic
1020144446 7:5631982-5632004 CAGAAGATGCAGAGAGTGGCTGG + Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1027002974 7:74667179-74667201 CTGAAAATACAGAAGTTAGCTGG + Intronic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031018285 7:116598696-116598718 CTCAAAAAGCCGAAGGTGGCTGG - Intergenic
1034203475 7:149296498-149296520 CTAAATCTTCAGATGGTGGCGGG - Intronic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1038041148 8:23725421-23725443 TAGAAAGTGCAGAAGGTGGCTGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040699771 8:50047689-50047711 CTTACTTTGCAGAAGGTGACTGG - Intronic
1040877923 8:52172252-52172274 CTGAAAGTGCAGAAAATGGCTGG - Exonic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1044312151 8:90706286-90706308 CTGAATAGGCAAAAGGTAGAAGG - Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1048417819 8:134246084-134246106 CTGAATATTCATAATGTTGCTGG - Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1049646153 8:143736692-143736714 GTGACTATGGAGAAGGTGACTGG - Intergenic
1050404075 9:5289069-5289091 CTGAATAGGCAAAAGCTGGAAGG - Intergenic
1050425660 9:5510098-5510120 CTGAATAGGCAAAAGCTGGAAGG + Intergenic
1050752381 9:8955210-8955232 CAGAATATGAAAAAGTTGGCTGG + Intronic
1051145441 9:14022487-14022509 ATGAACATGCATGAGGTGGCTGG - Intergenic
1051290712 9:15542833-15542855 CTGAAAATGCAAAAGTTAGCTGG - Intergenic
1055733475 9:79303468-79303490 CTGAATATTCAAAAGATAGCAGG + Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056275036 9:84986201-84986223 CTGAATATGGAGCAGGGGTCGGG - Intronic
1056800445 9:89687118-89687140 ATGAATATGCAGAGAGAGGCTGG - Intergenic
1056955907 9:91081021-91081043 GAGAATATGCCCAAGGTGGCTGG + Intergenic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1057643704 9:96853562-96853584 CTGACAATGCAGAAGGGGCCAGG + Intronic
1058414158 9:104767883-104767905 CTGTATTTGCAGGAGGTTGCAGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1060535529 9:124383951-124383973 CTGAAGATGTAGGGGGTGGCGGG + Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1185701860 X:2236726-2236748 CTGAAAATGCTCCAGGTGGCCGG - Intronic
1186202859 X:7171459-7171481 TTGAATATGCAGAAGCTGATTGG - Intergenic
1186234616 X:7494063-7494085 CTAAAAATACAGAAGGTCGCTGG + Intergenic
1186362866 X:8861083-8861105 AGGAATATTCAGAAGTTGGCAGG + Intergenic
1186972440 X:14862203-14862225 CTGAATACGCCCAAAGTGGCAGG + Intronic
1187211731 X:17238635-17238657 CTGCATATGGAGTTGGTGGCAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1189699014 X:43696867-43696889 TTGCATATGCAGCACGTGGCAGG + Intronic
1191074920 X:56442460-56442482 ATGCATATGCAGAAGGTGCAGGG - Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1194205112 X:91002841-91002863 CTGAAATTGGAGAAGGTGCCCGG + Intergenic
1194740964 X:97573820-97573842 CTGAAAATACAGAAAGTAGCAGG - Intronic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195551253 X:106174233-106174255 CTGAATAGCGAGAATGTGGCAGG + Intronic
1195752530 X:108172818-108172840 CAGAAAATGCAGAAGATGACAGG + Intronic
1196198017 X:112855576-112855598 GTGCATATTCAGCAGGTGGCAGG + Intergenic
1196617820 X:117787424-117787446 CTGAATCATCAGAAAGTGGCGGG + Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199582363 X:149373021-149373043 CTCAATACTCAGAATGTGGCAGG + Intergenic
1200550932 Y:4577962-4577984 CTGAAATTGGAGAAGGTGCCCGG + Intergenic