ID: 1113429990

View in Genome Browser
Species Human (GRCh38)
Location 13:110241322-110241344
Sequence CAGCAGGGCTGGAGCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113429990_1113429995 4 Left 1113429990 13:110241322-110241344 CCAACTTGGCTCCAGCCCTGCTG 0: 1
1: 0
2: 3
3: 54
4: 394
Right 1113429995 13:110241349-110241371 CAAAGTCACATGGAAAACAGAGG 0: 1
1: 0
2: 3
3: 38
4: 383
1113429990_1113429994 -6 Left 1113429990 13:110241322-110241344 CCAACTTGGCTCCAGCCCTGCTG 0: 1
1: 0
2: 3
3: 54
4: 394
Right 1113429994 13:110241339-110241361 CTGCTGCTTTCAAAGTCACATGG 0: 1
1: 0
2: 3
3: 28
4: 332
1113429990_1113429996 19 Left 1113429990 13:110241322-110241344 CCAACTTGGCTCCAGCCCTGCTG 0: 1
1: 0
2: 3
3: 54
4: 394
Right 1113429996 13:110241364-110241386 AACAGAGGTAATCATGATCCAGG 0: 1
1: 0
2: 1
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113429990 Original CRISPR CAGCAGGGCTGGAGCCAAGT TGG (reversed) Intronic
901634948 1:10666197-10666219 GAGCAGGGTTGGAGTCAGGTAGG - Intronic
901770837 1:11529625-11529647 CATCGGGGCTGGAGCTAAGCAGG - Exonic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902631728 1:17708733-17708755 CCCCAGGAGTGGAGCCAAGTGGG - Intergenic
903070024 1:20722511-20722533 CAACAGAGGTGGGGCCAAGTGGG + Intronic
903532993 1:24046373-24046395 CAGCTGGGGTCGAGCCAAGTGGG - Intergenic
903767009 1:25741505-25741527 CAGGAGGGCAGGAGCCAGGCTGG - Intronic
904439179 1:30518628-30518650 CAGCATGGATGGAGCCCAGATGG + Intergenic
905295012 1:36948776-36948798 CTGGAGGGCTGGAGACAAGGAGG - Intronic
905357517 1:37395073-37395095 CGGCAGGGCTGGAGCCAAAGGGG + Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
906078976 1:43071253-43071275 CAGCAGGGCTGCAGGAAGGTGGG + Intergenic
906155518 1:43611897-43611919 CATCAGGGCTGAAGCCCTGTGGG + Intronic
906830367 1:49024913-49024935 CATCAAGGCTGGAGCCATATGGG - Intronic
906931933 1:50178222-50178244 CAGCAGGTCTGACGCAAAGTAGG + Intronic
906949537 1:50323275-50323297 GAGCAGGGATGGAGCCCAGACGG + Intergenic
909114147 1:71513694-71513716 CAGCAGAGGAGGAGCCAAGATGG + Intronic
909476092 1:76082351-76082373 CAGAATGGCTGGAGGCAAATGGG - Intronic
909984628 1:82145504-82145526 CAGCCAGGCTGTAGCAAAGTGGG - Intergenic
911117909 1:94265357-94265379 GAGCAGGGCCAGAGCCAAGGAGG - Intronic
911141294 1:94505295-94505317 CAGGAGGGCTTGAGCCCAGTAGG - Intronic
911167989 1:94742182-94742204 CAGCCTGGCTGGAGCCATCTGGG + Intergenic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
913957631 1:143319319-143319341 GAGCAGGGCTGGACCAACGTTGG + Intergenic
914051942 1:144144683-144144705 GAGCAGGGCTGGACCAACGTTGG + Intergenic
914127255 1:144821858-144821880 GAGCAGGGCTGGACCAACGTTGG - Intergenic
914903730 1:151727312-151727334 GAGCTGTGCTGCAGCCAAGTGGG - Intronic
915369833 1:155339454-155339476 CAGTAGGGCAGTAGACAAGTTGG + Intronic
916229920 1:162531492-162531514 CATCTGGGCTGGAGCGCAGTTGG - Intergenic
919755398 1:201062995-201063017 CAGCAGAGTTGGAGCCCAGCTGG + Intronic
919857854 1:201717925-201717947 CAACAGACCTGGAGGCAAGTGGG - Intronic
920342637 1:205284982-205285004 AAGCAGGGGGGGAGCCAGGTTGG - Intergenic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922795304 1:228336813-228336835 CGGCAGGGCAGGAGGCCAGTGGG - Intronic
922795859 1:228339114-228339136 CAGGTGGGTTGGAGCCAAGGGGG + Intronic
923489237 1:234468744-234468766 CAGCAGGGCTGCAGCAGAGTTGG - Intronic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
1063556117 10:7081333-7081355 GAACAGGGTTGGAGCCCAGTTGG - Intergenic
1063614301 10:7588994-7589016 CAGGACGGCTGGAGCCGAGATGG + Intronic
1063693791 10:8313043-8313065 CAGAAGGGCTAGAGCCAAAGAGG + Intergenic
1063814978 10:9760933-9760955 CAGCAGAGCTCGAGACAAGTTGG + Intergenic
1065258756 10:23902759-23902781 CAGCAGAGCTGGAGTCAATATGG + Intronic
1065777217 10:29132103-29132125 CTGCAGAGCAGGAGCCCAGTTGG + Intergenic
1066237768 10:33502908-33502930 CCGCAGGGATGGAGCAAAGTAGG + Intergenic
1066961578 10:42231504-42231526 GAGCAGGGCTGGGCCAAAGTTGG + Intergenic
1067208812 10:44241883-44241905 GAGCTGGGGTGGAGCCAGGTGGG + Intergenic
1067471628 10:46542172-46542194 CTGCAGGGCAGGGGCCAGGTGGG + Intergenic
1067665174 10:48271483-48271505 CAGGAGGGCTGGTGCCAGGCAGG - Intronic
1068050892 10:51947598-51947620 CAGCAGGAGGGGAGCCAAGATGG - Intronic
1068340065 10:55689075-55689097 AAGCAGGGGAGGAGCCAAGATGG - Intergenic
1068514508 10:58009184-58009206 GAGGATGGCTGGAGCCAAGGAGG + Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1069706147 10:70460037-70460059 AGGCAGGGCTGGAGCCAATTTGG - Intergenic
1069729847 10:70603457-70603479 CAGCAGGGCTGGAGCCAGCGTGG - Intergenic
1069917343 10:71795756-71795778 CAGCAGGGATGGAGCAGAGCAGG - Exonic
1071904675 10:90159461-90159483 CAGGAGGGGAGGAGCCAAGATGG - Intergenic
1072199155 10:93143249-93143271 CAGCAGGGCTAGAGCAGAGAGGG - Intergenic
1072996463 10:100249102-100249124 CATCAGGGCTGTGGCCCAGTTGG - Intronic
1073050204 10:100662168-100662190 CAGCAGGGCAGGAGCCAATCTGG - Intergenic
1074282104 10:112062387-112062409 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
1075229926 10:120667220-120667242 GAGCAGGTCTGGAGCTGAGTCGG + Intergenic
1075501947 10:122982828-122982850 CAACAGGACTGAAGCCATGTGGG + Exonic
1076467108 10:130690533-130690555 CAGCAGAGCTGGAGCCATGAAGG - Intergenic
1076827438 10:132976148-132976170 CAGCAGGGCCAGGGCCAGGTGGG + Intergenic
1077508198 11:2941739-2941761 CAGCAGGACAGGAGCAGAGTGGG + Intergenic
1077656514 11:4024343-4024365 CAGCAGAGCTGGGACTAAGTGGG - Intronic
1078337837 11:10477746-10477768 CAGCAGGGCTGGAGGCTGGGTGG + Intronic
1078771757 11:14358598-14358620 CCGCAGGGCAGGAGCGTAGTCGG + Intronic
1078813954 11:14800754-14800776 CAGGGGGAATGGAGCCAAGTTGG - Intronic
1079587896 11:22148934-22148956 CAGGAAGAATGGAGCCAAGTTGG - Intergenic
1082122279 11:48392015-48392037 CAGGAAGGTTGGAGCCAAGGTGG - Intergenic
1083009972 11:59387778-59387800 CCTCAGGGGTGGAGCCAAGATGG - Intergenic
1083362945 11:62124063-62124085 CCGAAGGCCCGGAGCCAAGTGGG + Exonic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1084825064 11:71723724-71723746 TAGCGGGGGTGGAGCCAAGATGG + Intergenic
1084967195 11:72750994-72751016 AAGCATGGCTGGAGCCCAGGTGG + Intronic
1086240707 11:84686878-84686900 CAGCAGAGTAGGAGCCAAGGAGG - Intronic
1086918406 11:92557627-92557649 CAGCATGGCTGGATTCAGGTGGG - Intronic
1087362959 11:97183952-97183974 CAGCAGGGCTAGAACAAAGCAGG + Intergenic
1088810313 11:113387661-113387683 CAGCAGGGATGGAGCGACCTGGG - Intergenic
1089570170 11:119402584-119402606 CAGCAAGGCTGAAGCCAAGGAGG - Intergenic
1089612157 11:119675378-119675400 TAGGGGGCCTGGAGCCAAGTGGG - Intronic
1091629246 12:2146865-2146887 AAGCAGGGCTGGACCCAAGCAGG + Intronic
1092062262 12:5561112-5561134 TAGCACGGTTGGAGCCAAGTGGG + Intronic
1092418040 12:8307164-8307186 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
1092650781 12:10632439-10632461 CAGTGTAGCTGGAGCCAAGTGGG + Intronic
1092863532 12:12740442-12740464 CCTCAGGGCTGAAGCAAAGTAGG - Intronic
1092948580 12:13479336-13479358 CAGCAGGGCAAGAGCCAAGCTGG + Intergenic
1093599391 12:21002948-21002970 CGGCAGGGGTGGGGGCAAGTTGG - Intergenic
1093662829 12:21776393-21776415 CAGCATTGATGAAGCCAAGTTGG + Intergenic
1095160307 12:38906648-38906670 CAGCAAGACTGGTGCCAAGACGG + Intronic
1095615124 12:44179583-44179605 CAGCAAGGCTGGAACAAAGCAGG - Intronic
1096212284 12:49775998-49776020 CAGCACGGCTGGAGTCACCTGGG + Intergenic
1096786503 12:54019841-54019863 CTGCAGGGCTGTAGCCAGGAAGG - Intronic
1096895626 12:54818703-54818725 AAGGAGGGGTGGAGCCAAGATGG - Intergenic
1097960140 12:65524253-65524275 CAGCAGGGGTGAGGCAAAGTGGG + Intergenic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1098146068 12:67499053-67499075 CAGCATGGCTGGTGCCAAACTGG - Intergenic
1100384855 12:94096327-94096349 CAGCATGGCTAGAACAAAGTAGG - Intergenic
1100853322 12:98736285-98736307 CAGCAGAGCTTGTGACAAGTTGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101968402 12:109296124-109296146 CAGCAGGGCTGGTACCATGCAGG - Intronic
1103618925 12:122174039-122174061 CTGCAGGGATGGAGCCAGGGTGG - Intronic
1104430345 12:128711026-128711048 CTGCAGGGCTGGTGCTCAGTGGG - Intergenic
1104602105 12:130161453-130161475 CTGCGGGGCTGCAGCCAAGGAGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1105441327 13:20417428-20417450 CAGAAGGGCTGGACTCAGGTAGG - Intronic
1105653401 13:22405586-22405608 AAGCAGGGCAGGAGCAAACTGGG - Intergenic
1108750748 13:53445890-53445912 ACACAGGGCTGGAGCCAACTGGG + Intergenic
1109854906 13:68114241-68114263 AAGCAAGGCTGGGGCCAGGTTGG + Intergenic
1112143948 13:96676902-96676924 CAGCAGGTTTGGAGCTTAGTTGG + Intronic
1112485139 13:99812826-99812848 TAGCAGCCCTGGAGACAAGTGGG + Intronic
1113179446 13:107608937-107608959 CACCAGGGATGGTGCCGAGTGGG + Intronic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113460059 13:110476056-110476078 CAGCAGGGCTGGAGACAGTCTGG - Intronic
1113649773 13:112027274-112027296 CAGCAGGGCTGGGGACAGGCTGG + Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1115335460 14:32240737-32240759 CTGCAGGGGAGGAGCCAAGATGG - Intergenic
1117158652 14:52965900-52965922 CAGCATGGCTTGAGCCCAGGAGG - Intergenic
1117938217 14:60931503-60931525 CAGCTGGGCTGGACCAAAATAGG + Intronic
1119223225 14:72925920-72925942 CAGCAGTACTGGAGCCAACACGG + Intergenic
1121509786 14:94503833-94503855 CAGCAGGGGTGGACCCAAATTGG + Intronic
1121616126 14:95315001-95315023 GAGAAGGGATGGAGCCAAGGAGG - Intronic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1122945397 14:105006320-105006342 CTGCAGGGCAAGAGCCAGGTGGG - Intronic
1126029465 15:44481988-44482010 CAGCAGGGCTGCTGTTAAGTTGG - Intronic
1127316118 15:57795565-57795587 CAGCACTGCTGAAGCCAAATGGG - Intergenic
1127836600 15:62795583-62795605 CAGAAGGGCTGGAGTCTAGAGGG - Intronic
1127916521 15:63459498-63459520 CAGCTGGGCTTGAGTCTAGTGGG + Intergenic
1128388619 15:67167738-67167760 CTGCTGGTCTGGAGCCAATTTGG - Intronic
1128553742 15:68615988-68616010 CAGCAGGTCTGGCGCACAGTAGG - Intronic
1128619978 15:69140592-69140614 AAGCAGGGCAGGAGGCAAGTGGG - Intergenic
1129457386 15:75683113-75683135 CAGCAGGACTGGAGCCCTGGTGG - Intronic
1129726405 15:77903832-77903854 CAGCAGGACTGGAGCCCTGGTGG + Intergenic
1130146767 15:81280350-81280372 CAGCATGGCTGGAGCTAGGTGGG + Intronic
1131076111 15:89495975-89495997 CAGCAGGGCTGGCGCTTATTTGG + Intronic
1131111959 15:89770103-89770125 CCCCAGGGCTGTAGGCAAGTTGG + Intronic
1132141729 15:99402663-99402685 AAGAGGGGCTGGAGCCCAGTGGG - Intergenic
1132599893 16:768745-768767 CAGCAGGGCTGGGGCCAGCAAGG - Exonic
1132632179 16:923519-923541 CAGCACAGCTTGAGCCCAGTAGG + Intronic
1133522351 16:6571281-6571303 CAGCAGGACTGGAATCCAGTGGG + Intronic
1133770260 16:8863627-8863649 CATCTGGGCTGAAGCCAAGCTGG + Intronic
1136111493 16:28066350-28066372 CAGCAGGGAGGGATCAAAGTGGG + Intergenic
1137053845 16:35734331-35734353 CCGCAGGGGTGGAGGCAAGCGGG - Intergenic
1137569780 16:49557827-49557849 TTGCAGGGCTGGAACCAAGGGGG - Intronic
1138340937 16:56288727-56288749 CAGCAGGGGTGGAGGCGGGTAGG + Intronic
1139546938 16:67653816-67653838 GAGCAGAGCTGGTGGCAAGTGGG + Intronic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142309494 16:89304067-89304089 CAGCAGGGCTGTAGAGAAGCTGG + Intronic
1143726153 17:8847990-8848012 CACCAAGGCTGAAGCTAAGTAGG - Intronic
1144775211 17:17781830-17781852 CGGCAGCGGTGGCGCCAAGTGGG - Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145747064 17:27328246-27328268 CAGCAGGGCAGGGGGCAGGTGGG + Intergenic
1146599759 17:34204483-34204505 ATGCTGGGCTGGAGCCCAGTGGG + Intergenic
1146657746 17:34645028-34645050 GAGCAGGGCTGGAGCACAGAGGG + Intergenic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1147120087 17:38330674-38330696 CAGCAGAGCTGGAGCCAAGGTGG + Exonic
1147860347 17:43517481-43517503 CGGCAGGTCTGGGGCTAAGTTGG + Intronic
1149310818 17:55391345-55391367 TAGCAGGGCTGATGTCAAGTGGG + Intergenic
1149407805 17:56372406-56372428 CAGCAGGGCTGGAGAGCAATGGG + Intronic
1149547062 17:57511494-57511516 CAGCAGGACTTGAGCCCAGATGG - Intronic
1150001833 17:61445164-61445186 CAGTAGGTCTGTGGCCAAGTAGG + Intergenic
1150526599 17:65929780-65929802 CAGCAAGTCTTGAACCAAGTTGG - Intronic
1152472906 17:80500183-80500205 CAGCATGGCTGCAGTCAAGCTGG - Intergenic
1152517536 17:80834557-80834579 CCCCGGGGCTGGATCCAAGTGGG + Intronic
1152934089 17:83125958-83125980 CGTCAGGGCTGGAGTCAAGCTGG - Intergenic
1160212723 18:76895967-76895989 CCGCAGTGCTGCAGCCACGTGGG + Intronic
1160517517 18:79486727-79486749 CTGCAGGGCTGCAGGCAGGTCGG - Exonic
1160727786 19:625186-625208 CAGCAGGTCCGGAGTCAAGCCGG + Exonic
1160948414 19:1654213-1654235 CAGGATGGCTGGAGCCAAGCGGG - Intergenic
1161013307 19:1970451-1970473 CAGAAGGGACGGAGCCAGGTGGG - Intronic
1161243524 19:3236081-3236103 CAGCAGGGCTGGACCTCATTTGG + Intronic
1161636481 19:5392548-5392570 AGGCAGGGCTGGAGCAAAGGAGG - Intergenic
1161760994 19:6172788-6172810 CAGGTAGGCTGGTGCCAAGTAGG + Intronic
1162312717 19:9916599-9916621 CAGGAGGCCTGGAGCCCAGTTGG - Intronic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1163248493 19:16111798-16111820 CAGCGGGCCTGGAGCCAATAAGG + Exonic
1163255729 19:16154688-16154710 CAGCAGGGCTGGCGCTGGGTAGG - Intronic
1163623498 19:18374583-18374605 CAGCAGGGCTGGGACCATGGGGG - Intergenic
1164812247 19:31166491-31166513 CAGGAAGGCTGCAGCCAAGAAGG + Intergenic
1164873644 19:31667818-31667840 AAGCAGGGCTGGTCCAAAGTGGG - Intergenic
1164888677 19:31804713-31804735 CACCTGGGCTGCAGCCAGGTAGG - Intergenic
1165119295 19:33548788-33548810 CAGCAGGGATGGGGGCAGGTAGG + Intergenic
1165141968 19:33705114-33705136 GAGCAGGCATGGAGCCAAATAGG - Intronic
1165226227 19:34357198-34357220 CAGCAGTGCTGGAGGCCAGAGGG + Intergenic
1165255831 19:34576855-34576877 CAGCAGGGCGGGAGCTAGGGAGG + Intergenic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166322513 19:42027418-42027440 CAGCAAGGCTGGAGCAGAATAGG + Intronic
1167758195 19:51426474-51426496 CAGCAGGGCCTGAGCCCAGCAGG + Intergenic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1202691340 1_KI270712v1_random:97107-97129 GAGCAGGGCTGGACCAACGTTGG + Intergenic
925010858 2:484911-484933 CAGCAGATGTGGTGCCAAGTCGG - Intergenic
925900441 2:8505512-8505534 CAGCATGGCTGGAGCGATGCGGG - Intergenic
926155647 2:10452519-10452541 CACCAGGGCTGGGGCAAGGTAGG - Intergenic
926425727 2:12737006-12737028 CAGAAGGACTGGGGCCAAGCTGG + Intronic
927139055 2:20117628-20117650 CAGCAGGGCTGGGGCCAGCGTGG + Intergenic
927518005 2:23683126-23683148 AAGCAGGGCTGGGGCCAGGAAGG + Intronic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928966988 2:36986656-36986678 CACCCAGGCTGGAGCCCAGTGGG + Intronic
929818646 2:45256609-45256631 CAGCAGCGCAGGAGCCAGGACGG + Intergenic
930007491 2:46909733-46909755 CAGCTGGGCTGCAGCCTAGAGGG + Intronic
930080519 2:47443487-47443509 GAGAAGGGCTGCAGCAAAGTGGG + Intronic
930416017 2:51092530-51092552 CAGCAGGCCTGGACCCAAGTTGG + Intergenic
932265511 2:70364219-70364241 CAGCAGCTCTGGAGCCACTTGGG - Intergenic
933103002 2:78283948-78283970 CAGCAGTGCTGTAGGCAGGTTGG - Intergenic
933519001 2:83347470-83347492 CAGGAGGGGAGGAGCCAAGATGG + Intergenic
934273945 2:91563641-91563663 GAGCAGGGCTGGACCAACGTTGG + Intergenic
935051996 2:99531912-99531934 AGCCAGAGCTGGAGCCAAGTAGG + Intergenic
936428377 2:112437437-112437459 CTGGAGGGCTGGAGCCCACTTGG - Intergenic
936501638 2:113071624-113071646 AAACAGGGCTGTAGCCAAGGTGG - Intronic
937245780 2:120491647-120491669 TGGCAGGGCTGCAGCCCAGTTGG + Intergenic
938371258 2:130769757-130769779 CACCAGGGCTGGAGAAAAGGAGG - Intergenic
938445458 2:131373806-131373828 AAGGAGGGGTGGAGCCAAGATGG + Intergenic
939016529 2:136910230-136910252 AAGCAGGAGTGGAGCCAAGAGGG + Intronic
939423504 2:142004115-142004137 CAGCAATGCTGGAGACAAGAAGG + Intronic
941242584 2:163057981-163058003 CAGGAGGGCAGGAACAAAGTTGG - Intergenic
942494965 2:176530383-176530405 AAGCAGATCTGGAGACAAGTTGG - Intergenic
942521191 2:176806037-176806059 CTGCATGGCTGAAGCCAGGTGGG + Intergenic
943996070 2:194767011-194767033 CACCAGGGATGGAGGCAAATAGG + Intergenic
944139901 2:196444686-196444708 GAGCAGGGAAGGAACCAAGTTGG + Intronic
946162868 2:217846704-217846726 CAGCATGTCTGGGGCCATGTTGG - Intronic
946376094 2:219309618-219309640 CTACAGGGATGGGGCCAAGTGGG - Intronic
948908235 2:240989958-240989980 GAGCAGGTCTGGAGCCCACTGGG - Intronic
1168832393 20:853733-853755 CAGCATGGCTGCAGCAGAGTAGG - Intronic
1170612593 20:17926735-17926757 CAGCAGAGTTGGAGCCTACTGGG + Intergenic
1171183094 20:23105349-23105371 AGGCAGTGCTGGAGCCCAGTGGG - Intergenic
1171444895 20:25196116-25196138 CAGCAGGGCTGGGGCCCCCTGGG - Intronic
1172432293 20:34902543-34902565 CAGCATGTTTGGAGCCTAGTAGG + Intronic
1172517447 20:35544776-35544798 CAGAAGGGCTGGTGCCACGCGGG + Intronic
1173246850 20:41342909-41342931 CTCCAGGGCTGGATCCGAGTAGG + Intronic
1174162048 20:48558195-48558217 CAGCAGGGCTGCCTCCAATTAGG - Intergenic
1174416329 20:50369672-50369694 CAGCAGGGCCAGGGCCAGGTGGG - Intergenic
1175871130 20:62210051-62210073 CAGCAGGGCTGGAGCAGGGAGGG - Intergenic
1175940600 20:62535923-62535945 CAGCAGGGCTGGACACAAATGGG + Intergenic
1176192071 20:63816282-63816304 GAGCAGAGATGGAGCCAAGAGGG - Intronic
1176373874 21:6077774-6077796 CTGGAGGGCTGGAGCCCACTTGG + Intergenic
1176389990 21:6158451-6158473 CAGGAAAGCTGGAGCCCAGTAGG - Intergenic
1177132075 21:17271302-17271324 CAACAGGGGTGGAGCCAAGATGG + Intergenic
1178736142 21:35153766-35153788 CAGCAGGTCTGGAGCACAGCTGG + Intronic
1178965061 21:37109072-37109094 CGGTAGGGGTGGAGCCAAGATGG + Intronic
1179461692 21:41539685-41539707 CAGCAGGCCTGGGGACAAGAAGG + Intergenic
1179733476 21:43379789-43379811 CAGGAAAGCTGGAGCCCAGTAGG + Intergenic
1179749603 21:43460469-43460491 CTGGAGGGCTGGAGCCCACTTGG - Intergenic
1180902762 22:19386586-19386608 GAGAAGGGCAGGAGCCAAGATGG - Intronic
1181006911 22:20017814-20017836 CAGCAGGGATGCTGCCCAGTGGG + Intronic
1181107381 22:20583135-20583157 CAGCCTGGCTGGAGCCAGCTGGG - Exonic
1181468525 22:23123804-23123826 CAGCAGGGCTGAGGCAAGGTAGG + Exonic
1182897883 22:33873799-33873821 GGGCAGGGCAGGACCCAAGTGGG - Intronic
1182965365 22:34516456-34516478 CAGCAGGGCTGATGTCAAATTGG - Intergenic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183230721 22:36580313-36580335 CAGCAGGAGTGGAACCAAGGAGG - Intronic
1183495298 22:38139929-38139951 CAGGAGAGCTGGAGCCCAGCAGG + Intronic
1183829053 22:40408456-40408478 CAGCAGGGCTGGTGCAGGGTGGG - Intronic
1183983803 22:41558138-41558160 CAGAAGCGCTGGAGCCATGGTGG - Intergenic
1183989455 22:41588655-41588677 TAGCAGGACTGGAGCAAAGGTGG - Intronic
1184059064 22:42070942-42070964 ACGCAGGGCGGGAGCCCAGTGGG - Intergenic
1184211723 22:43040057-43040079 CAGGTGGGCTGGAGCCAGGTGGG - Intronic
1184279788 22:43430425-43430447 GAGCAGGGCTGGAGCCTGGTGGG + Intronic
1184772769 22:46607605-46607627 CAGCGGAGATGGAGCCAAGCAGG - Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185314624 22:50173712-50173734 CAGCAGGGCTGGCTCCAAGGGGG + Intronic
950004016 3:9679849-9679871 CAGCAGGGCTGGAGTGTAGCAGG + Intronic
950359621 3:12441144-12441166 CAGATGGGCTGGAGCCAGGAAGG + Intergenic
950597286 3:13995843-13995865 CAGGAGGGGAGGAGCCAAGATGG - Intronic
950775509 3:15346561-15346583 CCCCAAGGCTGGAGCCAAGATGG - Intergenic
951982005 3:28576096-28576118 CGCCAGGGCCGGAGCCAAGCAGG + Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952857281 3:37782665-37782687 CGGGAGGCCTGGAGCCATGTGGG - Intronic
952900977 3:38111679-38111701 TAGCAGGGCAGGAGGCATGTTGG - Exonic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953702921 3:45210590-45210612 GAGGAAGGCTGGAGCCCAGTAGG - Intergenic
953925349 3:46979836-46979858 CAGCAGGGCCGGAGCCGGGCCGG + Exonic
954325232 3:49859806-49859828 CAGCACGGCTGCAGCCCAGTCGG - Exonic
954691680 3:52399058-52399080 CTGCAGGCCTGGATCCAAGATGG + Exonic
954729181 3:52643313-52643335 CAGTCTGGCTGCAGCCAAGTTGG + Exonic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
956465601 3:69517804-69517826 CAGCAGGAATGGAGCCAGATAGG - Intronic
957094618 3:75767299-75767321 CAGCAGGGCAGCAGCCGAGCTGG - Intronic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
958039614 3:88210596-88210618 GAGCAAGGCTGGAACCAAGGTGG - Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958833251 3:99114963-99114985 CAGAGGGGCTGGAGCTAAGATGG + Intergenic
960382010 3:116974458-116974480 CTGCAGGGCTGCAGACAAGCTGG - Intronic
961307382 3:125968332-125968354 CAGAAGACCTGGAGACAAGTTGG + Intergenic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961595608 3:128013901-128013923 CACCAGGGATGGAGCCTTGTGGG - Intergenic
961786271 3:129348943-129348965 CAGCAAGGCTGGAGCACAGAGGG + Intergenic
961895740 3:130166542-130166564 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962377101 3:134867455-134867477 GAGCTGGGCAGGGGCCAAGTAGG + Intronic
962836820 3:139196748-139196770 CAGCCGAGGTGGAGCCAAGACGG - Intronic
964024412 3:152054790-152054812 TAGCAGAGCTGTAGCAAAGTAGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964498208 3:157318177-157318199 CAGCAGGGCTGATACCATGTTGG + Intronic
964768708 3:160202690-160202712 CAGCAGGGCTGGGGTCAAGATGG - Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
966420920 3:179733282-179733304 CAGCTGGGTGGGAGACAAGTCGG + Intronic
966669354 3:182509365-182509387 CAGCAGGGAAGGGGGCAAGTGGG + Intergenic
968771853 4:2512601-2512623 CAGCAGAGCTGGGGGCACGTTGG - Intronic
969040143 4:4289756-4289778 CAGCAAGCCTGAAGCCCAGTCGG + Intronic
969109241 4:4831507-4831529 CAGCAGGGCTGGCTCCTGGTGGG - Intergenic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969306282 4:6327912-6327934 AAGCAGGGCTGGATCCAAGTGGG - Intronic
969614430 4:8244149-8244171 GAGCAGGGCTGGAGACCAGTGGG - Intergenic
969965523 4:10990551-10990573 CAGCAGAGGTGGAGCAAAGCTGG + Intergenic
970250879 4:14114665-14114687 TAGCAGCTCAGGAGCCAAGTGGG - Intergenic
970623186 4:17848536-17848558 AGACAGGGCTGGAGCCAAGATGG + Intronic
970689282 4:18603256-18603278 CCCCAGGGGTGGAGCCAAGATGG - Intergenic
970767179 4:19563757-19563779 CACCAGGGCTGGAGACAAGAAGG - Intergenic
971953905 4:33391129-33391151 CAGCAGGGCTTCAACCACGTGGG - Intergenic
972315296 4:37920616-37920638 GGGCAGGGCTGGAGCCATGCAGG + Intronic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
974021895 4:56698916-56698938 AAGCAGGGATGGGGCCAAATTGG - Intergenic
974877684 4:67717968-67717990 CAGCATGGCTGGAGACACGCTGG + Intergenic
976763613 4:88576417-88576439 CAGCATGGCTGGAGCAGAGTGGG - Intronic
977045531 4:92064553-92064575 CTGCAGGACTGCAGCCAAGTAGG - Intergenic
979972286 4:127150362-127150384 CAGATAGGGTGGAGCCAAGTGGG - Intergenic
981407718 4:144391550-144391572 AAGCTGGGCTGGAGCCAAGATGG + Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981765769 4:148247792-148247814 CAAAAGGGCTAGAGCCAATTTGG - Intronic
983347812 4:166548944-166548966 CTGCATGGCTAGAGACAAGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985771647 5:1815502-1815524 CTTCAGGGCTGGAGCCCAGGAGG - Intronic
986034109 5:3922024-3922046 CACCAGGTCTGGTTCCAAGTGGG - Intergenic
986191724 5:5502693-5502715 CAGCATGGCTGGAACCAAGCAGG + Intergenic
986731488 5:10637816-10637838 CAGCAGCGCTGCAGCCAGGGCGG + Intronic
987047326 5:14120263-14120285 CAGGCGGGCTGGTGCCAGGTTGG - Intergenic
987111216 5:14688776-14688798 CGGCAGGGCTGTAGCCCTGTGGG + Intronic
987758740 5:22131401-22131423 CAGCAACTATGGAGCCAAGTTGG - Intronic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
990437670 5:55809446-55809468 AATCAGGGGTGGAGCCAAGATGG - Intronic
990554510 5:56917774-56917796 CTTCAGGGCTGCAGCCAGGTTGG - Intergenic
991587567 5:68215861-68215883 CAGCCGGGCTGGAGGCCGGTCGG + Exonic
991893443 5:71364840-71364862 CAGCAACTATGGAGCCAAGTTGG - Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992633993 5:78709754-78709776 CAACTGGGGTGGAGCCAAGATGG + Intronic
992659597 5:78945408-78945430 TAGGAGGGGTGGAGCCAAGATGG - Intronic
994281153 5:97903279-97903301 TATCAGGGGTGGAGCCAAGATGG - Intergenic
995527231 5:113059786-113059808 CAGCAGGCCTGTAGCCTGGTGGG + Intronic
995633887 5:114163132-114163154 CTTCAGGGGTGGAGCCAAGATGG - Intergenic
999323926 5:150631490-150631512 CAGCATGGCTGGAGCCTGGCAGG + Intronic
999867839 5:155720074-155720096 GAGGAGGGGTGGAGCCAAGATGG - Intergenic
1001929672 5:175664022-175664044 AAGTGTGGCTGGAGCCAAGTTGG + Intronic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003744709 6:8987528-8987550 CACCAGGAATGGAGCCCAGTTGG - Intergenic
1004399013 6:15271235-15271257 CAGGAGGGCTTGAGGCCAGTGGG + Intronic
1004649485 6:17594872-17594894 GAGCAGGGCTGGAGAAAAATTGG + Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1006434302 6:34018343-34018365 CAGCAGAGCTGAAGCCAACGTGG - Intergenic
1006877680 6:37312945-37312967 CAGCATGTCTTGAGACAAGTTGG - Exonic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009341010 6:62555067-62555089 CTGCTCGGCTGGAGCCAAGAAGG + Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1010482860 6:76375574-76375596 AAGATGGGCTGGAGCCAAGATGG - Intergenic
1011318072 6:86057942-86057964 CGGGAGGGCTGGAGCCAAGATGG - Intergenic
1012821915 6:104095441-104095463 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1013075741 6:106769810-106769832 GAGAATTGCTGGAGCCAAGTAGG - Intergenic
1013201678 6:107903662-107903684 TACCAGGGCTGGAGTCCAGTAGG - Intronic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1016611947 6:145999736-145999758 CTGCAGGGGTGGAGCCATCTTGG - Intergenic
1017036268 6:150270035-150270057 CAGCAGGGCTGGAGCCTGCAGGG + Intergenic
1018339062 6:162830352-162830374 CAGTATGGCTGGAGCCATGTGGG - Intronic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1019530269 7:1499665-1499687 CAGCCGGGCAGCAGCCAGGTTGG + Intronic
1019594235 7:1851036-1851058 CAGCCCGGCTGGAGCCAACAAGG + Intronic
1020107629 7:5429453-5429475 CGGCAGGGCTGGGGCCTAGCGGG - Intergenic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1021156299 7:17215214-17215236 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1021262906 7:18480988-18481010 CTGCAGGGCTGCAGCCTAGGTGG - Intronic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023103305 7:36740265-36740287 CTGCAAGGCTGGAGTCCAGTTGG + Intergenic
1023806557 7:43876906-43876928 GAGCAGGGCTGCAGCCCAGATGG - Exonic
1025122209 7:56314663-56314685 GAGCAGGGGAGGAGCCAAGAAGG - Intergenic
1025607183 7:63047769-63047791 CAGCAGGCCTGGGGCAAAGCAGG - Intergenic
1025869150 7:65414783-65414805 CTGAAGGGGTGGAGCCAAGATGG + Intergenic
1026153721 7:67809716-67809738 CAGCATGGCGGCAGCCACGTGGG - Intergenic
1026487161 7:70831266-70831288 CAGCTGGGCTTGAGACAAGAGGG - Intergenic
1027400053 7:77798113-77798135 CAGAAGCCCTGGAGCCAAGCAGG + Intronic
1028749621 7:94368091-94368113 CAGCAGAGCTGGAGGCCATTAGG - Intergenic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029596181 7:101538661-101538683 CAGCAGGGCCTGAGCCCAGGGGG + Intronic
1029962307 7:104700895-104700917 CAGCAGGCCTGGAGATAAATTGG - Intronic
1032085939 7:128884016-128884038 CAGCAGTGCTGGGGCCCAGGGGG + Exonic
1034313485 7:150110415-150110437 CAGCAAGGCTGGAAGCAGGTGGG + Intergenic
1034457312 7:151177751-151177773 GAGCAGGGGTGGAACCTAGTTGG + Intronic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1034793375 7:153990249-153990271 CAGCAAGGCTGGAAGCAGGTGGG - Intronic
1035229384 7:157454528-157454550 AAACAGGGGTGGAGCCAAGATGG - Intergenic
1035317232 7:158003703-158003725 CCGCAGGGCTGGAGCCCGGATGG - Intronic
1035698045 8:1615107-1615129 CAGAAGGGATGGAGCCATGGAGG + Intronic
1035757117 8:2042920-2042942 CAGGAAGCCTGGAGCCAAGAAGG - Intergenic
1035920101 8:3667488-3667510 CAGGGTGGCTGGAGCCAACTAGG + Intronic
1036370202 8:8155946-8155968 TAGCAGGAGTGGAGCCAAGATGG + Intergenic
1036880690 8:12509685-12509707 TAGCAGGAGTGGAGCCAAGATGG - Intergenic
1036924711 8:12893059-12893081 CAGCAGGGCTGCAGAGAACTGGG + Intergenic
1037290689 8:17346504-17346526 GAGCAGGCGTGGAGCCATGTGGG + Intronic
1038007580 8:23445595-23445617 CATGGAGGCTGGAGCCAAGTGGG - Intronic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038763634 8:30407473-30407495 CAGCAGGGCCTAATCCAAGTAGG - Intronic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1040686749 8:49881249-49881271 CACCAGGGATGGAGCCAAGATGG - Intergenic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041291337 8:56311122-56311144 GAGCAGGGCTGGAACCAAACAGG + Intronic
1041876780 8:62697283-62697305 CAGCATGGCTGGAACAGAGTAGG - Intronic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1045223498 8:100221857-100221879 CAGCAGGGCTGGGACCACATGGG - Intronic
1048384840 8:133902277-133902299 GAGGAAGGCTGAAGCCAAGTTGG - Intergenic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1048931834 8:139321413-139321435 ATGCAGGGCTGGAGCCCAGGTGG + Intergenic
1049691866 8:143965052-143965074 CAGGTGGGCTGGGGCCAAGTGGG - Intronic
1049693306 8:143972173-143972195 CAGGAGGGCTGGAGCCCAGGTGG + Intronic
1049797794 8:144504513-144504535 CAGTGGGGCTGGGGCCAACTCGG - Intronic
1049843625 8:144789319-144789341 CAGCAGGGCTGTAGCCAGTATGG + Intergenic
1050117201 9:2275261-2275283 CAACAGGGCTGAAGCCTAATGGG - Intergenic
1050509171 9:6376260-6376282 CATCAGGGGAGGAGCCAAGATGG + Intergenic
1050820226 9:9869866-9869888 CAGCAGAGATTGAGACAAGTGGG + Intronic
1051275010 9:15390315-15390337 TAACAAGGCTAGAGCCAAGTAGG + Intergenic
1055544692 9:77357276-77357298 CAGCCAGGCTGGAGCGCAGTGGG - Intronic
1056938546 9:90936481-90936503 CAGCAGGGTTTGATCCAAGTGGG - Intergenic
1058237807 9:102514739-102514761 CAGCTGGGCTGCAGCCAAGGAGG + Intergenic
1059245874 9:112849124-112849146 CAGCAGGGCAGGGGCCATGTGGG - Intronic
1060171983 9:121469371-121469393 CAGCATGGCTGGATCCAAGGAGG + Intergenic
1060677162 9:125525733-125525755 GAGCAGGGGTGGAACCAGGTAGG + Intronic
1060815107 9:126631049-126631071 CGGCAGGCCTGGAGCCAAAGGGG + Intronic
1061008454 9:127941742-127941764 CAGCAGCGCTGGGGCCCAGCTGG - Exonic
1061564230 9:131426969-131426991 CAGCATGGCTGAAGCCATGTGGG + Intronic
1062175339 9:135159011-135159033 CAAAAAGGCTGGAGCCAAGTGGG + Intergenic
1062247093 9:135574823-135574845 CAGCAGGGGTGGGGCCATGCTGG - Intergenic
1062291816 9:135798719-135798741 GTGCAGGGCTGGAGACAAGGAGG - Intergenic
1062421368 9:136484126-136484148 CAGCAGGGCTGGGGCCAGGGTGG - Exonic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1187308761 X:18121105-18121127 CAGCAGGGCAGCAGTAAAGTGGG - Intergenic
1188366277 X:29319230-29319252 CAGCCAGGCTGGAGCGCAGTGGG + Intronic
1189016216 X:37098712-37098734 CAGCAGGGCCTAATCCAAGTAGG - Intergenic
1190085704 X:47393648-47393670 CAGCTGGGTTGGAGCCCAGGAGG - Intronic
1190246969 X:48697008-48697030 CAGCGGGCCTGGGGCTAAGTGGG + Intronic
1190536515 X:51433582-51433604 CAGGAGGGGGGGAGCCAAGATGG - Intergenic
1191114942 X:56842304-56842326 AATCAGGGGTGGAGCCAAGATGG - Intergenic
1191144620 X:57152900-57152922 CAGCGGGGGGGGAGCCAAGGTGG - Intergenic
1191834889 X:65454000-65454022 CAGAAAGGGTGGAGCCAAGATGG + Intronic
1192660583 X:73037818-73037840 CCGGGGGGCTGGAGCCAAGATGG - Intergenic
1193844934 X:86456273-86456295 CAGAAGGCCTGGGGCCAAGATGG - Intronic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1197453909 X:126653146-126653168 CAGCATGGCATGAGCAAAGTAGG - Intergenic
1197827040 X:130600942-130600964 GAGCTGGGGTGGAGCCAATTGGG + Intergenic
1199673576 X:150166227-150166249 GACCAGGGCTTGAGCCAAGCAGG - Intergenic
1201451465 Y:14120267-14120289 GACCAGGGCTTGTGCCAAGTGGG + Intergenic