ID: 1113433318

View in Genome Browser
Species Human (GRCh38)
Location 13:110268834-110268856
Sequence CAGGTGAGACACAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 1, 2: 5, 3: 40, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113433312_1113433318 -5 Left 1113433312 13:110268816-110268838 CCATCTTCCAGCCGAGGGCAGGT 0: 1
1: 0
2: 3
3: 8
4: 188
Right 1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG 0: 1
1: 1
2: 5
3: 40
4: 438
1113433310_1113433318 -4 Left 1113433310 13:110268815-110268837 CCCATCTTCCAGCCGAGGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG 0: 1
1: 1
2: 5
3: 40
4: 438
1113433309_1113433318 -1 Left 1113433309 13:110268812-110268834 CCGCCCATCTTCCAGCCGAGGGC 0: 1
1: 0
2: 1
3: 21
4: 190
Right 1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG 0: 1
1: 1
2: 5
3: 40
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113433318 Original CRISPR CAGGTGAGACACAAGGAGGA GGG Intronic
900432051 1:2607097-2607119 CACGTGAGCCACAGGGAGGCTGG - Intronic
901674380 1:10874438-10874460 CAGGTGGGACCCAGGGAGGTTGG + Intergenic
901681534 1:10915733-10915755 CAGGTGGGTCAGAAGCAGGAGGG + Intergenic
902385308 1:16072785-16072807 CAGGTCAGACACAGAGAGAAAGG + Intronic
902396986 1:16137789-16137811 CAGGTGGGGCTTAAGGAGGACGG - Intronic
902618265 1:17635574-17635596 CAGATGAGACAAAAACAGGATGG - Intronic
903027066 1:20436958-20436980 CAGGTCAGACTCAAGCAGTAAGG - Intergenic
903209946 1:21812327-21812349 CTGGTGGGACACAAGGAGAAGGG - Exonic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904298226 1:29537654-29537676 AAGGTGAGAGACAGGGAGGGAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905288767 1:36907272-36907294 AAGATGTGAGACAAGGAGGAAGG + Intronic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
906954393 1:50359888-50359910 GAGGTGTCACCCAAGGAGGATGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908780967 1:67689347-67689369 CAGGGGAGCCATAAGGGGGACGG - Intergenic
909372308 1:74898084-74898106 CAGGTGAGACACAATGAGGAAGG - Intergenic
912138882 1:106696949-106696971 AAACTGAGACACAAGGAAGAAGG + Intergenic
912795059 1:112688370-112688392 CAGGTGGAACCCAAGCAGGAAGG - Intronic
913212422 1:116592564-116592586 AAGGTGAGACATCAGGAAGAGGG + Intronic
913537922 1:119791898-119791920 CAGTTGTGACCAAAGGAGGAGGG + Intergenic
916274444 1:162978548-162978570 CGGGTGGGAAACAAGGAGGCGGG + Intergenic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917041070 1:170807104-170807126 CAGGTTAGACGCCAGGAAGAAGG + Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
918315513 1:183319484-183319506 CAGGAGAGTCACAAGCAGGCTGG + Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918956851 1:191218733-191218755 CAGGAGAGACACAGAGAGAAAGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920440761 1:205979092-205979114 GAGGGGAGACACAGGGAAGAAGG - Intronic
921669773 1:217912746-217912768 CAGGAGAGAGACAGAGAGGAGGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922824854 1:228510633-228510655 CAGGTGACAGACCAGCAGGATGG - Intergenic
923591375 1:235322788-235322810 GGGGTGAGACAGAAGGAAGAGGG + Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1064174068 10:13059031-13059053 CAGATGAGAAACAGGGAGGAAGG + Intronic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065874391 10:29984187-29984209 CAGGTGAGCCAACAGGTGGAGGG + Intergenic
1065889810 10:30111182-30111204 CAGGTGAGGAACAGGGTGGAAGG - Intronic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070645416 10:78198781-78198803 ATGCTGAGACACAAGGAGGAAGG + Intergenic
1070853357 10:79585249-79585271 CAGGCCAGGCACAAGGAGAAGGG + Intergenic
1070998722 10:80810382-80810404 CAAGTGAGAAAGAAGGAGGGAGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1071143912 10:82544621-82544643 AGGGTGAGAGACATGGAGGAGGG + Intronic
1073901861 10:108231732-108231754 CAGGTGACCCACAAGGCTGATGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075465728 10:122648873-122648895 CAGGTGGGATAACAGGAGGATGG - Intergenic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1076589224 10:131571754-131571776 AAGGTGCCACACAAGGAGGCTGG + Intergenic
1076605503 10:131686896-131686918 CAGGTGAGAGAACAGGAGGGAGG - Intergenic
1078533025 11:12151624-12151646 TTGGTGAGCCACAAGAAGGAAGG - Intronic
1079399033 11:20091016-20091038 CAGGTGAGAGCCCAGGAGCATGG + Exonic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079950969 11:26803927-26803949 GAGGTGAGAAAAAAGGAGCATGG - Intergenic
1081934662 11:46896425-46896447 CAGATGAGACTCAAGGTGGGAGG + Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083226969 11:61291369-61291391 CAGGTGAGACACGAGGAACTGGG + Intronic
1083296915 11:61719893-61719915 CAGGAGAGACTCCAGGGGGAAGG + Intronic
1083554937 11:63618598-63618620 CAGCTGAGACCCTAAGAGGATGG + Intergenic
1083887495 11:65580050-65580072 CAGGGGAGAGACCAGGAGAAGGG - Intronic
1083997557 11:66279620-66279642 CAGGTGAGGCACCGGGAGGAAGG - Intronic
1085054380 11:73395283-73395305 GAGGTGAGAGTCAAGGAGAAAGG + Exonic
1086070079 11:82790372-82790394 CAACTGTGACACAAGAAGGAAGG - Intergenic
1086302435 11:85442057-85442079 AAGCTGAGACACAATGAGCAAGG + Intronic
1086910060 11:92461703-92461725 GAGGTGAGGCACAGGGAAGAGGG + Intronic
1087748970 11:101984797-101984819 CAGCTGAGGCACAAGGAAGTGGG - Intronic
1088042361 11:105402821-105402843 AAGGTGAAATACAAGGAGAAGGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089569036 11:119390246-119390268 CAGATGAGCCACAATGAGAAAGG - Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091081028 11:132667972-132667994 CAAGTGAGCAACAGGGAGGAAGG + Intronic
1091130619 11:133144045-133144067 AAGATGAGACACAAGGAGGCAGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092414751 12:8281819-8281841 AGGGTGAGAAACAGGGAGGAAGG + Intergenic
1092483180 12:8879062-8879084 CAGGACAGACACAAGGATGGAGG - Intronic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1093481955 12:19613031-19613053 CAGGTAAGACACATTCAGGAAGG - Intronic
1094076134 12:26475926-26475948 AGGGTGGGCCACAAGGAGGAAGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095601343 12:44016422-44016444 CAGGTGGGACACAGGGAGAAAGG - Intronic
1096109884 12:49022260-49022282 CAGGTGAGAGATGACGAGGAAGG - Exonic
1096689059 12:53308262-53308284 AAGGTGAGAGGCAAGGATGAAGG - Exonic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1098661672 12:73102080-73102102 CAGGTGAGACAAAAGAAGTATGG - Intergenic
1100895361 12:99176187-99176209 CAGGTGAGAGACCAGGAAGTGGG + Intronic
1103658231 12:122491854-122491876 CAGGTGAAACACTAGGTGAATGG + Intronic
1104466423 12:128994307-128994329 CACCTGAGACAGGAGGAGGAAGG + Intergenic
1105215667 13:18283187-18283209 AAGGTGAGACATCAGGAAGAGGG + Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106192526 13:27466274-27466296 CAGGTCAGACTCAAGGTGCATGG - Intergenic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1107094627 13:36522081-36522103 CAGCTGAGATGCAAGGAGGTGGG + Intergenic
1107361623 13:39624590-39624612 CAGGGGAGAACCAAGGAAGAAGG - Intergenic
1107655417 13:42588282-42588304 CAGGGGAGACCCAGGGAAGAAGG + Intronic
1110367291 13:74701269-74701291 CAGGTGAGACACAATGAATGAGG + Intergenic
1110560773 13:76908801-76908823 CAAATGGGACACAAAGAGGAGGG - Intergenic
1111764006 13:92503225-92503247 AAGGTGAGACAGTAGGAGGGAGG - Intronic
1113225905 13:108159273-108159295 CAGCTGAGAAAAGAGGAGGAAGG + Intergenic
1113379846 13:109794091-109794113 CAGGAGAGACGCACAGAGGAGGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113534242 13:111051579-111051601 CTGGTGAGACGCCAGGAGGGTGG + Intergenic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1116288287 14:43001431-43001453 CAATTGAGACAGAAGGAAGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116974625 14:51101725-51101747 TGGGTGAGAGACAAGGAGGAGGG - Intergenic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119357306 14:74018269-74018291 CAAGTGGGAAACAAGGCGGAGGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1121331092 14:93050257-93050279 CAGCTGAGACTCAAGCAGGCAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1122115757 14:99526521-99526543 GAGGTGAGACCCAGGGAGCAAGG + Intronic
1122149422 14:99716970-99716992 CAGGTGAAAGGCATGGAGGAAGG + Intronic
1123196772 14:106624525-106624547 CAGATGAGGCACAAGAAGGAAGG - Intergenic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123462042 15:20481913-20481935 TAGGTGAGACAAACGGTGGATGG + Intergenic
1123656014 15:22518475-22518497 TAGGTGAGACAAACGGTGGATGG - Intergenic
1123771854 15:23537079-23537101 CAGGTGAGACATAATGAGGAAGG - Intergenic
1124258185 15:28163074-28163096 CAGGTGAGTCTCAGGGAGGGCGG - Exonic
1124272728 15:28297898-28297920 TAGGTGAGACAAACGGTGGATGG + Intronic
1124309924 15:28613648-28613670 TAGGTGAGACAAACGGTGGATGG - Intergenic
1124346983 15:28929577-28929599 CAGGCGACACACAAGAAGAAGGG + Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125502602 15:40248738-40248760 CACGTGAGACACAAGAGGGCTGG - Intronic
1126065332 15:44822215-44822237 CAGGTCAGGCACAAGGGGAAGGG + Intergenic
1126094501 15:45078368-45078390 CAGGTCAGGCACAAGGGGAAGGG - Intergenic
1126261528 15:46698484-46698506 CAGGCGAGCCACAAGGAGCTGGG + Intergenic
1127660941 15:61099471-61099493 CAGGAAAGATACAAGGAGAATGG + Intronic
1127800835 15:62476208-62476230 CAGGTGACAAAGCAGGAGGAGGG - Intronic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1129080183 15:73032666-73032688 GAGGTGAGACTCGAAGAGGATGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130686900 15:86046037-86046059 GAGGTGAGAGACAGGGAGGCAGG - Intergenic
1131011746 15:89023483-89023505 CAGCTCATACTCAAGGAGGAGGG - Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131390199 15:92041697-92041719 CAGGTGACACGCAGGAAGGATGG - Intronic
1131761202 15:95624410-95624432 CAGTTGAGACAGAAGAAGTAAGG + Intergenic
1132353674 15:101156131-101156153 CAGGTGAGACAAAGGGGAGAAGG + Intergenic
1132822189 16:1879801-1879823 CATGTGAGCCCCAAGAAGGAAGG - Intronic
1133023182 16:2975793-2975815 CAGGTGCGCTCCAAGGAGGACGG - Exonic
1133690981 16:8214798-8214820 AAGGAGAGACAAAAGGAGTAAGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135149447 16:19992731-19992753 GAGCTGACACACAAGGAGGGTGG - Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1136392594 16:29974646-29974668 CAGGTGAGACACGGGGTGCAGGG + Exonic
1136451659 16:30357275-30357297 CTGGTGAGACAAAAGCAGGGGGG + Exonic
1136585737 16:31183472-31183494 CATGTGATACATAAGGAGGTGGG + Intronic
1136620812 16:31427517-31427539 CAGGTGAGAGACAGGGAGCTGGG + Intergenic
1138156062 16:54703888-54703910 CCGTTGAAACACTAGGAGGAAGG + Intergenic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1139321067 16:66114466-66114488 CAGGTCAGATTCAAGGAGGCTGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140694805 16:77522087-77522109 CAGGTGAGATAGAAAAAGGAAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141170215 16:81686219-81686241 CAGGTGGGAGGAAAGGAGGAAGG + Intronic
1141727555 16:85799750-85799772 CAGGTGAGACAGGAGGTGGCCGG + Exonic
1142064156 16:88050981-88051003 CAGATGAGAAACAAGCAGGCTGG - Intronic
1142331015 16:89453913-89453935 CAGTTGAGGCACAAGGAAGTTGG - Intronic
1143387049 17:6537164-6537186 CAGGTGAGGGACAAGGAGGGTGG - Intronic
1144083678 17:11787455-11787477 TTGGTCAGACTCAAGGAGGAAGG - Intronic
1144628214 17:16856348-16856370 ATGGTGACACACCAGGAGGAGGG + Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146176598 17:30669238-30669260 CAGGTGTGCCAAAATGAGGACGG + Intergenic
1146350060 17:32085353-32085375 CAGGTGTGCCAAAATGAGGACGG + Intergenic
1147383904 17:40070905-40070927 GAGGAGAGACACATGAAGGAGGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1147970129 17:44214888-44214910 CAGATGGGACACGAGGAAGATGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1149016017 17:51909151-51909173 CAGGTGAGATAGAAGGTGAAAGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1149789135 17:59462037-59462059 CAGGCAAGACATAAGGAGGTAGG + Intergenic
1149958618 17:61081799-61081821 CAGATGAGAGACAAGGAGCTGGG - Intronic
1151131934 17:71905650-71905672 TACGTTAGCCACAAGGAGGAAGG + Intergenic
1151420932 17:73997069-73997091 CAGGTGACACACCAGGAGATGGG + Intergenic
1152076600 17:78163933-78163955 CAGCCCAGACACAAGGTGGAGGG + Intronic
1152608088 17:81303004-81303026 CAGCTGAGGCTCCAGGAGGAGGG + Intergenic
1152698261 17:81806842-81806864 CAGGCGGGGGACAAGGAGGAAGG - Intronic
1152939878 17:83162783-83162805 CACGTAAGTCACATGGAGGAGGG + Intergenic
1153600227 18:6773921-6773943 GAGCTGAGACACAAACAGGAAGG + Intronic
1153823645 18:8855037-8855059 CTGGTGAGAGACAAGAAGGCAGG + Intergenic
1155000806 18:21684777-21684799 CAGGTGAGCCACAAAGAGCCTGG + Intronic
1155734681 18:29205873-29205895 CAGGTGATACACATGCAGGATGG - Intergenic
1157809001 18:50679850-50679872 CAGGAGGGACACAGGAAGGAGGG - Intronic
1159036969 18:63286707-63286729 CAGGTGAGAGGCAAGAAGTAAGG + Intronic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160675519 19:389171-389193 CAGGTGAGCAACAGGCAGGACGG + Intergenic
1160675530 19:389223-389245 CAGGTGAGCAACAGGCAGGACGG + Intergenic
1161978797 19:7620065-7620087 CAGGTCAGACACTAGGGGGTGGG + Exonic
1162087968 19:8259951-8259973 CAGGTGGGAGCCATGGAGGATGG - Intronic
1162346214 19:10119513-10119535 CAGGCGGGTCCCAAGGAGGATGG + Intronic
1162394131 19:10406316-10406338 GAGCTCAGACCCAAGGAGGAAGG - Intronic
1162957332 19:14106797-14106819 CTGGTGAAACACAAGGAGACCGG - Exonic
1163249418 19:16117650-16117672 GAGGTGAGAGACAAGGAAGATGG + Intronic
1163597318 19:18227633-18227655 CATGTGTCACACAAGGAGGAGGG + Intronic
1164417247 19:28057514-28057536 TGGGTTGGACACAAGGAGGATGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164671503 19:30074678-30074700 CAGGAGAGACTGGAGGAGGAAGG - Intergenic
1164794393 19:31014557-31014579 GAGGTGAGAGGGAAGGAGGAAGG + Intergenic
1165230666 19:34384578-34384600 CAGGTGAGGCCCAAGGAGTCCGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165838455 19:38773136-38773158 CCGGTGAGACCGAAGGAGGGAGG + Intronic
1165841104 19:38789561-38789583 CCGGTGAGACCGAAGGAGGGAGG - Intronic
1165992156 19:39822570-39822592 CAGGAGAGACCTAAAGAGGAAGG + Intergenic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1166633294 19:44427036-44427058 CAGGAGAGAGACAGCGAGGAAGG + Exonic
1166857205 19:45788429-45788451 CAGGTGAGCCCCAATGAGAAAGG + Intronic
1166882484 19:45937937-45937959 TAGGAGAGAGACAAGGAGGCTGG + Exonic
1167011840 19:46813709-46813731 GAGGTGAGAGAGAAGGAGGCGGG - Intergenic
1167111901 19:47467498-47467520 CAGGTCAGACACAGGGAAGCTGG - Intronic
925030911 2:649347-649369 TAGGAGAGACACAAGCATGATGG + Intergenic
925596522 2:5560957-5560979 ATGGTCAGTCACAAGGAGGAAGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925887354 2:8404277-8404299 TAGGTGATACACAAAGAGGGAGG - Intergenic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
926628799 2:15118464-15118486 CAGCTCAGATACAAGGTGGAAGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927461925 2:23306753-23306775 CAGGTTACATACAAGGATGAAGG + Intergenic
927815740 2:26215797-26215819 AAGATGGTACACAAGGAGGAAGG + Intronic
928138297 2:28705576-28705598 GAGTTGAGACACAAGAAGGCAGG - Intergenic
929373388 2:41254238-41254260 CAAGGGAGACACAAAGAAGAAGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930444571 2:51453509-51453531 CAGTGGAGACTCAATGAGGAAGG - Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934298663 2:91763538-91763560 AAGGTGAGACATCAGGAAGAGGG - Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934948665 2:98560924-98560946 CAGCTGACACACAACAAGGAGGG - Intronic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
938727985 2:134123533-134123555 CCCATGACACACAAGGAGGAAGG - Intronic
938783554 2:134606471-134606493 CAGGAGAGACTCGAAGAGGAGGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941740939 2:169034509-169034531 AAGCTGAGCCACAAGAAGGATGG + Intergenic
941847105 2:170143942-170143964 GGGGAGAGAGACAAGGAGGAAGG - Intergenic
942627948 2:177923474-177923496 CAGCTGAGATAAAAGGAGGATGG - Intronic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944137885 2:196419604-196419626 TAGGTGAGATATAAGTAGGAAGG - Intronic
944229771 2:197380911-197380933 TAGGTGGGAGAGAAGGAGGACGG + Intergenic
944341072 2:198600306-198600328 AAGGTGTGACCCGAGGAGGATGG + Intergenic
945705539 2:213226832-213226854 TTGGTGAGACACAAGAAGAAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945995534 2:216432839-216432861 CAGGTGAAGCGCACGGAGGATGG - Exonic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
947406412 2:229781897-229781919 CAGGTAAGACCCATGAAGGAAGG + Intronic
947821471 2:233074235-233074257 GTGGTGAGACACACAGAGGATGG + Intronic
947829135 2:233126370-233126392 CAAGTGAGAGAGTAGGAGGAGGG - Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948109532 2:235443682-235443704 CAGGGGAGGGACAAGAAGGAGGG - Intergenic
948371049 2:237489167-237489189 CAGGTGAGGCTGTAGGAGGATGG - Intronic
948637571 2:239349230-239349252 CACGAGAGACACACGGAGGGAGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1170053802 20:12176533-12176555 CAGGTGGGGCCCAAGGTGGAGGG + Intergenic
1170327367 20:15171378-15171400 AAAGAGAGACACAAGGAGAAAGG - Intronic
1170781502 20:19429933-19429955 CAGCTGAGAAAAAAAGAGGAGGG + Intronic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1173186309 20:40843215-40843237 AAGGTGAGAAGGAAGGAGGAAGG - Intergenic
1174173600 20:48631718-48631740 GTGGTGAGACACACGCAGGAAGG + Intronic
1174556588 20:51399982-51400004 CAGGTGAGACACGGGGAGGAGGG - Intronic
1175220254 20:57412558-57412580 AAGGTGAGGTTCAAGGAGGATGG - Intergenic
1175308573 20:57995127-57995149 AAGGTGAGGCACAAAGAGGTTGG - Intergenic
1175957368 20:62618266-62618288 ACTGTGAGACACGAGGAGGAAGG + Intergenic
1176049736 20:63112359-63112381 CATGTGAGACACATGCAGGTGGG - Intergenic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1178846244 21:36176390-36176412 CAGCTCATACACAAGGAGGCTGG - Intronic
1180965185 22:19784484-19784506 CAGGTAACACGCAGGGAGGAAGG + Exonic
1181018908 22:20088044-20088066 CAGGTGAGACCCCAGGCTGAGGG + Intronic
1181410303 22:22713680-22713702 CAGGTGGGTCACATTGAGGAGGG - Intergenic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183347194 22:37314391-37314413 CAGATGGGACTCAAGCAGGATGG + Exonic
1183843423 22:40519519-40519541 CAGTTTGGACACAAGGAGGTTGG - Intronic
1183987858 22:41579141-41579163 GAGGAGAGACACGAGTAGGAAGG + Intronic
1184056343 22:42052801-42052823 CAGGTGAGAGACAGGGAGGCTGG - Intronic
1184563418 22:45276612-45276634 CAGGTAAGACACAGGGAGTAGGG - Intergenic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
950153299 3:10704834-10704856 CAGGGGAGATACAAAGAAGATGG + Intronic
951576982 3:24123934-24123956 AAGGGGTGACACAAGGAGGCTGG + Intronic
952871570 3:37905595-37905617 CAGCTGTGGCACAAGGAGGGAGG - Intronic
952894909 3:38072056-38072078 AGGGTGAGAAACAAGGAAGAAGG + Intronic
953036891 3:39219970-39219992 CAGGTCAGACTCAAGGCTGATGG - Intergenic
953167591 3:40479103-40479125 CAGGTGAGACACTGCTAGGATGG - Intronic
953367186 3:42354835-42354857 GAGGTGGGAGAGAAGGAGGAGGG - Intergenic
954030204 3:47813815-47813837 CTGGAGATACACAAGGAGGCAGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955726181 3:61935197-61935219 GAGGTGAGAGACAAGGATGGGGG - Intronic
956223997 3:66935665-66935687 CAGGAGAGAAACAGGAAGGAAGG + Intergenic
957513571 3:81221996-81222018 CAGGTGATAAACAGGGAGGTGGG - Intergenic
957575429 3:82001401-82001423 CAGGTGACTTCCAAGGAGGATGG - Intergenic
957847123 3:85752442-85752464 CATATGAGACATAAGGAGAAGGG - Intronic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
962182656 3:133224892-133224914 CAGGTGGGACCTAAGGATGAAGG - Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
963734465 3:149004157-149004179 CAGGTGAGAGACAGGGAGAAAGG - Intronic
965895020 3:173565069-173565091 GATGAGAGACACAAGGAGTACGG + Intronic
966442123 3:179957344-179957366 CAGGTAAGGCTCAGGGAGGAAGG + Intronic
966542286 3:181105625-181105647 CAGGAGATACAAAAGGCGGATGG + Intergenic
966836976 3:184056802-184056824 CAGGGGAGACCCCAGAAGGAAGG + Intronic
967808111 3:193732807-193732829 AAGGTGAAAGACAAGCAGGATGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968431205 4:560183-560205 CATGTGAGACAGATTGAGGATGG + Intergenic
969227824 4:5810648-5810670 CAAATGAGACACAAACAGGAAGG - Intronic
969479130 4:7437845-7437867 CAGGTGAGAGGAAAGGAGGGAGG - Intronic
969479246 4:7438793-7438815 CAGGTGAGAGGAAAGGAGGGAGG - Intronic
971060714 4:22966120-22966142 TAGTTGAGACAAAAGTAGGAAGG - Intergenic
971580653 4:28335120-28335142 CAGGTGAGAGAGAAGGCCGAAGG - Intergenic
972993225 4:44848217-44848239 AAAGTGAGACAAAAGGAGGCAGG - Intergenic
973533021 4:51851655-51851677 CAGGTGGGGCACAGGGAGGGAGG + Intronic
973895650 4:55410071-55410093 CTGGTGGGAGGCAAGGAGGAGGG - Intronic
973942482 4:55924606-55924628 CAGGTGGGATTCAAGGAAGAAGG + Intergenic
974852618 4:67421907-67421929 CAGGTGTGACACAAGGCTCAAGG - Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
980237658 4:130130277-130130299 AAGGTGAGAAACACAGAGGATGG + Intergenic
980877775 4:138679295-138679317 CAGGAGAGACACAAGTAGTCTGG + Intergenic
981786376 4:148483788-148483810 CAGCAGAGCCACAAGGTGGAAGG - Intergenic
983321108 4:166198156-166198178 CCAGTGAGACACCAGGTGGAAGG + Intergenic
984092197 4:175387879-175387901 CAGGTGTCACTCAAGGAGGCTGG - Intergenic
984475917 4:180234884-180234906 CAGCTGTGGGACAAGGAGGAAGG - Intergenic
984637885 4:182133019-182133041 CAGGCGAGTCAGGAGGAGGAGGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985822102 5:2167276-2167298 CTGGTGTGACCCAAGGCGGAGGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
990317953 5:54601801-54601823 CAGGTGAGAAATGAGGAAGAAGG - Intergenic
992406457 5:76462065-76462087 AAGTTGAGGCACTAGGAGGAAGG + Intronic
994427532 5:99610630-99610652 CAAGTGAGTCTGAAGGAGGAGGG + Intergenic
995531222 5:113093764-113093786 CAGATGAGTGACAAGCAGGAAGG + Intronic
995580596 5:113597280-113597302 CAGTTGAGAAATAAGTAGGAAGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996479081 5:123952952-123952974 GAGGTGAGATATAAGGAGGAGGG + Intergenic
997259356 5:132454266-132454288 CAGGAGAGAGACAGGCAGGAGGG - Intronic
997712081 5:136014239-136014261 TAGGTGAGACACAGGGAGAGAGG + Intergenic
998146667 5:139733196-139733218 CAGGTCCGAGGCAAGGAGGACGG + Intergenic
998215819 5:140238046-140238068 CAGGTGAGACACAGGTTGGTGGG + Intronic
998511131 5:142714858-142714880 CAGGAGAGAGACAGGAAGGATGG - Intergenic
999381960 5:151127574-151127596 ACGGTGAGACCCAAGGAGGAAGG - Intronic
999409880 5:151341520-151341542 CAGGTCTGAAACAAGGAGAAAGG + Intronic
999571851 5:152927556-152927578 CAGGTGACACAGAAGGAGTTAGG + Intergenic
1001075800 5:168627259-168627281 CAGGTGAGACACCCAGGGGAAGG - Intergenic
1001219091 5:169883771-169883793 CAGGTGAGATTCAAGGAAGATGG - Exonic
1001589824 5:172857683-172857705 CACGTGAGACCCCAGGAGGAGGG - Intronic
1002801086 6:522131-522153 GAGAGGAGACACAAGCAGGAGGG + Intronic
1002927413 6:1612483-1612505 CAGGTGAGAGGCAAGGAAGAAGG - Exonic
1002937701 6:1687653-1687675 GAGGAGAGACACAAAGAGGCAGG + Intronic
1004452470 6:15759328-15759350 CAGCTGACACACAAAGAAGAAGG + Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1005709871 6:28493354-28493376 CAGTGGAGACACAAGTAGAAAGG - Intergenic
1006081937 6:31572839-31572861 CAGGTGAGGCAGCAGGAGAATGG + Exonic
1006239924 6:32668691-32668713 CAGGTGAGACACTCGGAATAAGG - Intergenic
1007046753 6:38783529-38783551 AAGGAGAGACACAGGAAGGAAGG - Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007387830 6:41531409-41531431 CAGGTGAGAGAACTGGAGGAGGG - Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008326419 6:50187521-50187543 CAGGAGAGAGAAAAGGAGGGAGG - Intergenic
1010016558 6:71110971-71110993 CAGGTGAGACTAGAGGGGGAAGG - Intergenic
1012542063 6:100372664-100372686 CAGGAAAGCCACACGGAGGATGG + Intergenic
1013000637 6:106018887-106018909 CACCTCACACACAAGGAGGAGGG + Intergenic
1015600158 6:134903839-134903861 TGGGTGAGACAGAGGGAGGAGGG + Intergenic
1016650037 6:146452192-146452214 AGGGTGAGAAACAAGGAAGAAGG + Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1019016434 6:168883831-168883853 CGGGTGAGACACACGGTGGTTGG - Intergenic
1019316694 7:390291-390313 GAAGGGAGACACAAGGCGGAAGG + Intergenic
1019346170 7:531764-531786 CAGGGGAGCCACGAGGCGGAGGG + Intergenic
1019644669 7:2122672-2122694 CAGGTGAGACTCAGGCAGGAAGG + Intronic
1023362263 7:39429214-39429236 AAGGTGAGAAACATGGGGGATGG - Intronic
1024198336 7:47081846-47081868 GAGGGGAGACACTGGGAGGAAGG + Intergenic
1024215045 7:47241395-47241417 CAGATGGGTCACAAGGAGCAAGG + Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024554527 7:50592087-50592109 CAGGTGTGTCTCAAGGAGGCTGG + Exonic
1025294824 7:57769111-57769133 AAGGTGAAACACAGAGAGGAAGG - Intergenic
1027512907 7:79105578-79105600 CAGCTGAGAAGCAAGTAGGATGG - Intronic
1028217108 7:88147231-88147253 CAGGTGAGAGTTAGGGAGGATGG - Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029687457 7:102158514-102158536 CAGGTTAGTCACAAGGAGACCGG - Intronic
1030426930 7:109389800-109389822 CAGGAGAGACTCAAGGGGAATGG + Intergenic
1031205731 7:118755169-118755191 AAGGTGAGTCACAAGGAGGCAGG + Intergenic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032579606 7:133092068-133092090 CATGTGTGACATAAAGAGGAAGG - Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1035027485 7:155835605-155835627 CAGGCGAGGCCCAAGGGGGATGG + Intergenic
1035045567 7:155963273-155963295 CAGGTAAGAGACAGGGTGGAGGG + Exonic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035737790 8:1901299-1901321 CAGGAGAGTCACTGGGAGGAAGG - Intronic
1035886807 8:3300000-3300022 GAGGTGACACACGGGGAGGATGG + Intronic
1036138405 8:6182834-6182856 CATGTGAGACACAAAGTGGATGG - Intergenic
1037178325 8:15973472-15973494 CAGGTGAGACACAACAAGGAAGG + Intergenic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1039690083 8:39853676-39853698 CAGATGTGACACAAAGAGCATGG - Intergenic
1039966897 8:42290314-42290336 CAGGTGGGACACCAGGAAGAGGG + Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040879337 8:52188650-52188672 AAGGTTAGAAACAAGGAGCATGG + Intronic
1041172605 8:55160351-55160373 AAGGTGAGAGACAGTGAGGAGGG + Intronic
1042166054 8:65947356-65947378 CAGGGGAGACACAAGCAATAAGG - Intergenic
1042780973 8:72490755-72490777 CAAGTGGGACACTAGGATGATGG - Intergenic
1043314641 8:78905356-78905378 CAAGTGAGTTAAAAGGAGGATGG - Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044429819 8:92095655-92095677 AAGGAGAGACACAGGCAGGAGGG + Intronic
1045472598 8:102525674-102525696 CAGGAGAGACACAGGAAAGAAGG + Intergenic
1046825358 8:118685011-118685033 GAGGTGAGAAACAGGGAGGGAGG - Intergenic
1047421250 8:124710059-124710081 CAGCTGACACAAAAGGAGGCAGG + Intronic
1047494841 8:125402165-125402187 CAGGTGAGATGCAAGGTGGAGGG - Intergenic
1047506992 8:125487913-125487935 TAGGTGAGAAAAAGGGAGGAAGG + Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048537584 8:135311997-135312019 CAGGTGAGAGAGAAGAATGAAGG + Intergenic
1048537800 8:135313793-135313815 CAGGTGAGAGAGAAGAATGAAGG + Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1049382378 8:142323801-142323823 GAAGTGAGACACAAGCGGGAGGG - Intronic
1049745228 8:144260454-144260476 GAGGTGGGAGACAGGGAGGAGGG - Intronic
1055112810 9:72576348-72576370 GAGGAGAGAGACAAGAAGGAAGG - Intronic
1056655084 9:88502622-88502644 CCTGGGGGACACAAGGAGGATGG - Intergenic
1056719957 9:89063106-89063128 CAGCTCAGACTCAAGGGGGAAGG - Intronic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058594545 9:106601352-106601374 CAGGAGAGATCCAAGGAAGAAGG + Intergenic
1058850732 9:109009638-109009660 CAGAAGAGAAACAAGGTGGATGG - Intronic
1059150206 9:111942811-111942833 GAGTTGAGAGACAAGCAGGAGGG - Intergenic
1059418065 9:114174298-114174320 CAGGTGAAACACAAGGGGCCTGG + Intronic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060546537 9:124465176-124465198 AAGGAGAGAGACCAGGAGGATGG - Intronic
1060781567 9:126416891-126416913 AAAGTGAGAGACAAGGATGAAGG - Intronic
1060847261 9:126847351-126847373 CAGGTGAGAGACAATGAGGATGG - Intergenic
1061076672 9:128345547-128345569 CAGGTGAGCCCCAAGGGGGCGGG + Exonic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061420736 9:130471827-130471849 CAGATGAGACACTTGGGGGAGGG + Intronic
1061634843 9:131901006-131901028 GAGGGGAGACACAAGGAGAGGGG + Intronic
1061848842 9:133403021-133403043 CCGGTGGGACAGCAGGAGGAGGG - Intronic
1062339413 9:136087379-136087401 CAGGTGACAGGCCAGGAGGAGGG - Intronic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1062529325 9:136992972-136992994 CAGGTGAGACCCAAGCAGGGAGG + Exonic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1185638725 X:1574018-1574040 AAGGTGAGACACACCGGGGAGGG + Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1186130934 X:6464661-6464683 CAGGTAAGACAGAAAGGGGAGGG - Intergenic
1187515593 X:19967040-19967062 CAGGTAAGAAACAAGCAGGAAGG + Intronic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1191266951 X:58405903-58405925 CAGGAGAGAAACTAGAAGGAAGG + Intergenic
1195970877 X:110471992-110472014 CAGGAGAGACCCAAGTATGATGG + Intergenic
1196812988 X:119643320-119643342 CAGCTGAGAGCCCAGGAGGAGGG - Intronic
1198131722 X:133702629-133702651 CAGCTGAGGCAAAAGTAGGAAGG + Intronic
1199993150 X:153001013-153001035 CTGGGGTGACCCAAGGAGGATGG + Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201613395 Y:15868354-15868376 CAGGTAAGACAGAAAGGGGAAGG - Intergenic