ID: 1113433607

View in Genome Browser
Species Human (GRCh38)
Location 13:110271331-110271353
Sequence GGCTCCTAATATGTATCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113433607_1113433609 0 Left 1113433607 13:110271331-110271353 CCACAAGATACATATTAGGAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1113433609 13:110271354-110271376 AAAGAAAAACAGTAACTTCATGG 0: 1
1: 0
2: 8
3: 115
4: 1046
1113433607_1113433611 14 Left 1113433607 13:110271331-110271353 CCACAAGATACATATTAGGAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1113433611 13:110271368-110271390 ACTTCATGGAGAGACCTGGTAGG 0: 1
1: 0
2: 2
3: 27
4: 347
1113433607_1113433610 10 Left 1113433607 13:110271331-110271353 CCACAAGATACATATTAGGAGCC 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1113433610 13:110271364-110271386 AGTAACTTCATGGAGAGACCTGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113433607 Original CRISPR GGCTCCTAATATGTATCTTG TGG (reversed) Intronic
902622427 1:17658291-17658313 GCCTCCTCATCTGTATGTTGAGG - Intronic
907309239 1:53529892-53529914 GGCTCCTCAGGTGGATCTTGAGG + Exonic
909303252 1:74039508-74039530 GGCTGCCCATATGTGTCTTGGGG - Intronic
917271419 1:173278983-173279005 GGCAGCTACTATGTTTCTTGTGG - Intergenic
921597079 1:217066149-217066171 GGCATGTAATATGTATGTTGTGG - Intronic
1063074307 10:2699799-2699821 GGCTCCTATTATGTGACATGTGG + Intergenic
1073674451 10:105629838-105629860 GGCTCCTCGTATGTGTGTTGGGG + Intergenic
1077810773 11:5634213-5634235 CACTCCTAATTTGAATCTTGAGG - Intronic
1081417808 11:42836574-42836596 AGCTCCTACTATGTAGCTAGAGG - Intergenic
1081635822 11:44721265-44721287 GACTCCTAATATTTAACATGAGG - Intergenic
1086124797 11:83339377-83339399 TCCTCCTAATATTTATGTTGTGG + Intergenic
1087469543 11:98553992-98554014 GGCTCAAAATATGAATTTTGGGG + Intergenic
1096199315 12:49670405-49670427 AGCTCCCAATATGCATCTAGTGG + Intronic
1104360961 12:128132787-128132809 GGCTCCTTATCTGTTTCCTGGGG - Intergenic
1106166353 13:27250262-27250284 GTCTCCTTATATGCCTCTTGTGG - Intergenic
1106982674 13:35307229-35307251 GACTCCTAATATTTCTCTTGTGG + Intronic
1107499699 13:40960789-40960811 AGTTACTAATATGTATCTTGTGG + Intronic
1108411118 13:50148164-50148186 GGCTCCTTTTATGTGTCTTCTGG - Intronic
1111229049 13:85316849-85316871 GGCACCTAATATTTATCCTCTGG + Intergenic
1112187902 13:97145619-97145641 GGCTTCAAATATATAGCTTGAGG - Intergenic
1112603567 13:100881209-100881231 TGCTCCAAATATATATCTAGAGG + Intergenic
1113433607 13:110271331-110271353 GGCTCCTAATATGTATCTTGTGG - Intronic
1116752352 14:48902385-48902407 GGCTCTTATTGTATATCTTGGGG - Intergenic
1125104934 15:35959648-35959670 GACTCCAAAAATGTATCTTTAGG - Intergenic
1125396566 15:39255248-39255270 GGCTTCAAATATGAATTTTGGGG - Intergenic
1128499715 15:68219475-68219497 GCCTCCAAAGATGTATCGTGAGG - Intronic
1129030810 15:72616370-72616392 GGCTCCAAGTATGAATTTTGAGG + Intergenic
1130153828 15:81332796-81332818 GGCTCCTCATTTTTATATTGGGG - Exonic
1132166151 15:99593089-99593111 GGTTCATAATATGTTTCTTTTGG + Intronic
1135269712 16:21058575-21058597 CGCTCCTGATCTGTAGCTTGAGG - Intronic
1135842885 16:25892795-25892817 GGCCCCTACTAAGTATCTTATGG - Intronic
1137859694 16:51833885-51833907 GGATCCTAATATCTGTCTTTGGG - Intergenic
1140269407 16:73451091-73451113 TGCTCCAAACATGTATCCTGTGG - Intergenic
1146907489 17:36627148-36627170 GGCTCTTAGTCTGTCTCTTGGGG + Intergenic
1146912675 17:36658441-36658463 GGCTCCTAATCTGCACCATGGGG - Intergenic
1147607343 17:41781681-41781703 GACTCCTCATTTGTATCTTTTGG - Intronic
1148467626 17:47874407-47874429 GGCTCCTAAAGTGAATTTTGAGG - Intergenic
1152917303 17:83047356-83047378 GGTTCCAAATATGAATCTCGGGG + Intronic
1165440871 19:35826602-35826624 GGATCCTGATATGTGTCTTCAGG + Exonic
935103782 2:100020801-100020823 GCCTCCTAAAATGTATCTCCCGG + Intronic
947078516 2:226369877-226369899 GGCACAAAATATGTAACTTGAGG - Intergenic
947241664 2:228001073-228001095 GGATTCTAATATGTATGTGGTGG + Intronic
1173542394 20:43863894-43863916 GGGTGGTAATATGTATGTTGAGG + Intergenic
1179097149 21:38326113-38326135 GGCTCTAAATATGTATCTTGCGG + Intergenic
1183152156 22:36046375-36046397 GTCTCCTAAAATGTATATTCTGG + Intergenic
951308235 3:21093100-21093122 GATTCCAAATATGTATTTTGGGG - Intergenic
953014875 3:39064241-39064263 GGATCCTAATAGGTACCTTGAGG - Intronic
956831105 3:73049134-73049156 TGCTTCTAAAATGTATCATGTGG - Intronic
962863634 3:139427994-139428016 TGCCCGTAATATATATCTTGAGG - Intergenic
965011124 3:163093190-163093212 AGATCTTAATTTGTATCTTGTGG - Intergenic
966984915 3:185171375-185171397 GACCCATAATACGTATCTTGAGG + Intergenic
975240895 4:72057739-72057761 GGCACTTAATAAGTATATTGTGG - Intronic
977059307 4:92237538-92237560 GGTTCCTAATATATATTTTTTGG - Intergenic
983041098 4:162928152-162928174 GTCTAATTATATGTATCTTGAGG + Intergenic
988095716 5:26606776-26606798 GTCTCCTACTAGGAATCTTGAGG + Intergenic
990718757 5:58669128-58669150 GGCTCAAAATATGAATTTTGGGG + Intronic
990985295 5:61636020-61636042 TGCTCCTAAATTTTATCTTGAGG + Intergenic
1001327237 5:170737987-170738009 GGGTCCTAACCTGCATCTTGAGG + Intergenic
1003223507 6:4183789-4183811 GGCTTCAAATATGAATTTTGAGG - Intergenic
1003498664 6:6686588-6686610 GGCTTCAAATATGAATTTTGAGG + Intergenic
1004236749 6:13881135-13881157 TGCTCCTAAGATGTATTCTGGGG + Intergenic
1008130734 6:47717968-47717990 GGCTCCTAATGTGAATCTGTAGG - Intronic
1008575795 6:52858954-52858976 GAGTCCTACTATGTATCTGGAGG - Intronic
1014249575 6:119101417-119101439 GGCTCATAATATTTATCTCAAGG - Intronic
1014962182 6:127700730-127700752 GGATTCTAATATGTATTTTATGG + Intergenic
1016395057 6:143615149-143615171 AGCTACTTATATGTAACTTGGGG - Intronic
1031121601 7:117728506-117728528 GGCTCCTGATATGTAAAATGGGG - Intronic
1032643792 7:133798597-133798619 GGCTCCTAATCTGTAAAATGAGG - Intronic
1038995609 8:32919776-32919798 GTCTCATAATATCTATCTTTGGG + Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041236347 8:55806633-55806655 GGCTCCTAATGTCTGTCTTAAGG + Intronic
1041323736 8:56642258-56642280 GGCTCCAAACATGTACCATGTGG - Intergenic
1046882247 8:119321885-119321907 TGGTCTTAATATGTAGCTTGAGG - Intergenic
1046943828 8:119956457-119956479 AGCTCCTACTAAGTATCTGGTGG - Intronic
1048679007 8:136817790-136817812 GGCTAATAATATTTATCTTGCGG + Intergenic
1056339450 9:85611119-85611141 GCCTCGTGATCTGTATCTTGTGG + Intronic
1058063040 9:100519111-100519133 GGATCTTAATATTTATCTTCAGG + Intronic
1058464982 9:105218041-105218063 GACTTCTAATATATATCCTGGGG - Intergenic
1058717038 9:107731792-107731814 GCCTCCTAACAGGTCTCTTGCGG + Intergenic
1062111463 9:134784436-134784458 AGCTCCCAATCTGTAACTTGAGG + Intronic
1186236977 X:7523114-7523136 GGCTCCTAATTTATGTCTGGGGG - Intergenic
1186345670 X:8689844-8689866 GGCTACTTATAATTATCTTGTGG + Intronic
1194398378 X:93413757-93413779 GAATACTAATATGTTTCTTGAGG - Intergenic
1198315498 X:135461796-135461818 GGCTCCTAAAATGTAACCTGTGG - Intergenic
1199705985 X:150425821-150425843 GGCTCTTCCTATGTACCTTGTGG + Intronic