ID: 1113435797

View in Genome Browser
Species Human (GRCh38)
Location 13:110290012-110290034
Sequence GTTGGCTGAAAGGATGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113435787_1113435797 30 Left 1113435787 13:110289959-110289981 CCTGGGAAGTAAAAATAGAGGGT 0: 1
1: 0
2: 1
3: 15
4: 206
Right 1113435797 13:110290012-110290034 GTTGGCTGAAAGGATGCTGCCGG 0: 1
1: 0
2: 1
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113435797 Original CRISPR GTTGGCTGAAAGGATGCTGC CGG Intronic
900288946 1:1915703-1915725 GTTGTCTGACAGGATTCTGCAGG - Exonic
900758175 1:4451880-4451902 GTTGGCTGTAAGGCCCCTGCAGG - Intergenic
901860713 1:12072674-12072696 GATGGCTGAAATGAAGCTGTGGG - Intronic
902642959 1:17778467-17778489 GTTGGCTGAAAGCATGTTGTCGG + Intronic
905858374 1:41330030-41330052 GCTGGCAGAAAGGATGATGGAGG - Intergenic
906070590 1:43013586-43013608 GGTGACTGACAGGATGCTGGGGG + Intergenic
907012366 1:50976473-50976495 GATGGATGAAACGGTGCTGCTGG + Intergenic
907483122 1:54758319-54758341 GTTGGCTGAGAAGCTGCAGCGGG + Exonic
910851450 1:91653240-91653262 GTTAGCAGAAAACATGCTGCTGG + Intergenic
912522162 1:110253071-110253093 GTTGGCTGAGAAGATGGGGCTGG - Intronic
921929158 1:220740854-220740876 GTCCACTGAAAGGCTGCTGCTGG + Intergenic
1067068232 10:43115419-43115441 GTTGCCTGAACGGAGGCTCCAGG - Intronic
1069035829 10:63645156-63645178 CTTGGCTGTTAGGATGGTGCTGG + Intergenic
1070156947 10:73841138-73841160 CTTGGCTGTGAGGATGCTGCAGG - Intronic
1072411008 10:95202085-95202107 GGTGTCTGAGAGGATGCTGGCGG - Exonic
1072913781 10:99524612-99524634 GGAGGCTGAGAGGAGGCTGCTGG + Intergenic
1073075247 10:100821112-100821134 GCTTGCTCAAAGAATGCTGCTGG + Intronic
1075339351 10:121633105-121633127 GCTGCCAGAAAGGATGCTGGAGG - Intergenic
1075849409 10:125574865-125574887 GTGGGCTGAAAGGAAGGAGCGGG + Intergenic
1076431176 10:130403457-130403479 GTTGCCTGAAAAGAGGCGGCAGG - Intergenic
1084596272 11:70118787-70118809 GATGGATGAATGGATGCTGAAGG + Intronic
1084714245 11:70863616-70863638 GTTGACTGAAAGGAGGCACCAGG - Intronic
1084953017 11:72677072-72677094 GATGGCAGGAAGGATGCTCCTGG + Intergenic
1085042799 11:73336520-73336542 GCTGGCTGAAAGGAGGATGGAGG - Intronic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1088760362 11:112923501-112923523 TTTATCTGAAAGGATTCTGCTGG + Intergenic
1089600445 11:119611220-119611242 GTGGGCTAAAAGGATGGTGCAGG + Intergenic
1092303101 12:7271222-7271244 ATTGGCTGAAAGGAGGTTGGAGG + Intergenic
1103719556 12:122966083-122966105 GGGCGCGGAAAGGATGCTGCAGG + Intronic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1107470871 13:40689890-40689912 GTGGCCTGAAAGGATGGTTCTGG + Intergenic
1107882812 13:44847941-44847963 GTTGTCTGGAAGGAACCTGCAGG - Intergenic
1113216831 13:108051250-108051272 GTTGTCTGGAAAGATGCTGTGGG - Intergenic
1113435797 13:110290012-110290034 GTTGGCTGAAAGGATGCTGCCGG + Intronic
1114675204 14:24435697-24435719 GTTGGCAGATAGGATGCTACTGG + Intronic
1116767723 14:49092490-49092512 GTGGACAGAAAGGATGCTGTTGG - Intergenic
1119621977 14:76138314-76138336 TTTGGGGGAAAGGTTGCTGCTGG + Intergenic
1119761116 14:77152581-77152603 GTTGGAATAAAGGATGCAGCTGG - Intronic
1120948803 14:90022295-90022317 GTTTACTGAAAAGATGCTGGGGG + Intronic
1120981422 14:90292602-90292624 GTTATCTGAAAGGAGGCCGCTGG - Intronic
1121057778 14:90874678-90874700 GCAAGGTGAAAGGATGCTGCAGG + Intronic
1121941861 14:98078474-98078496 GATAGCATAAAGGATGCTGCAGG + Intergenic
1124677144 15:31696190-31696212 GTTCTCTGTAATGATGCTGCAGG - Intronic
1125419393 15:39489004-39489026 GTTGGCAGACAGAATACTGCTGG - Intergenic
1125838320 15:42773791-42773813 GTTGGGAGAAAGGATGAAGCAGG + Intronic
1127264361 15:57349540-57349562 CTTGACTGAGAGCATGCTGCGGG + Intergenic
1128222590 15:65979665-65979687 GTTGGCTAAAAGGAGGCTTGTGG + Intronic
1129953245 15:79610473-79610495 GTTGCCTTAAAGGATGGTGGTGG - Intergenic
1130863153 15:87908925-87908947 GTTGGCTGGGAGGCTCCTGCTGG - Intronic
1132312574 15:100867840-100867862 GTTAGCAGAAAGGAAGTTGCTGG + Intergenic
1134202357 16:12209610-12209632 GGTGGCTGAAGGGATGCTCCTGG + Intronic
1136867276 16:33768255-33768277 TTTGGCTGAGAGGATGGTGGAGG - Intergenic
1136988801 16:35139660-35139682 GTTTGCTGATTGGATGCAGCAGG + Intergenic
1139288726 16:65838305-65838327 CTTGGCTGATTGGATGCTCCTGG + Intergenic
1140942079 16:79731421-79731443 GGAGGCTGAAAGGATCCTTCAGG + Intergenic
1203104886 16_KI270728v1_random:1347948-1347970 TTTGGCTGAGAGGATGGTGGAGG + Intergenic
1203128628 16_KI270728v1_random:1614420-1614442 TTTGGCTGAGAGGATGGTGGAGG - Intergenic
1142774695 17:2127622-2127644 GTTGAATGAAAGGAAGCTGCTGG - Intronic
1145023332 17:19448997-19449019 GATAGCTGAAAGAATGCTGAGGG - Intergenic
1145118113 17:20230935-20230957 GTAGGCTAAAAAGATGCTGTGGG - Intronic
1147162744 17:38577565-38577587 CTTGACTGAAAGGCTGCTGATGG + Intronic
1148387152 17:47242519-47242541 GTTGGCTGAATGGAGGCAGGAGG - Intergenic
1150598205 17:66626019-66626041 CTTTCCTAAAAGGATGCTGCTGG - Intronic
1150646212 17:66979008-66979030 GTTGGCTGGAAGGAGGGTGCGGG - Intronic
1151158321 17:72142988-72143010 GGTGGCTGCATGGATGCTGAAGG + Intergenic
1151766583 17:76136226-76136248 GATGGCTGAGAGGAAGATGCGGG - Intergenic
1151869029 17:76824098-76824120 GGTGGGTGGAAGGATGCTGAAGG - Intergenic
1151892470 17:76958765-76958787 GTTTGCTGAACGGATGGTGATGG - Intergenic
1151906173 17:77050776-77050798 GTTGGCAGAGAGGATGGTGGAGG + Intergenic
1156019159 18:32580129-32580151 GTAGGCTGTAAGTATGCTGGAGG - Intergenic
1156259166 18:35428645-35428667 GCTGGCTGAAACCATGCTGGGGG - Intergenic
1156289199 18:35730762-35730784 GATAGCTGAAAGAACGCTGCGGG + Intergenic
1157528700 18:48404798-48404820 ATTTGCTGAATGAATGCTGCGGG - Intronic
1160630327 18:80242426-80242448 GTTGGCTGCCATGGTGCTGCAGG - Intronic
1163442065 19:17327353-17327375 GGTGGCAGAGAGGAGGCTGCAGG + Intronic
1164129257 19:22346913-22346935 GTTGGCTGCAGGGATGAGGCTGG - Intergenic
1165293046 19:34904795-34904817 GCTGCCTGAAAGGAAGCAGCTGG + Intergenic
1165878560 19:39026830-39026852 GTTTGGGGAAAGGATGCTGGGGG - Intronic
1166596062 19:44051422-44051444 GATGGCTGAAAGGAGGCTCAGGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167932928 19:52882827-52882849 GCTAGCTGAAAGGATGAGGCAGG + Intronic
927089853 2:19702017-19702039 GTTGACTGAAAGGAAAATGCTGG + Intergenic
928252192 2:29690932-29690954 TTTGGCAGAAAGGGTGCTGGTGG - Intronic
929242982 2:39671477-39671499 CTTGGGTTAAAAGATGCTGCTGG + Intronic
932409798 2:71538903-71538925 GTTGCCTGATGGGATGCTGGTGG + Intronic
933841120 2:86286309-86286331 GTTGTCTGAGAGGGTGCTACTGG + Intronic
933909683 2:86928992-86929014 TTTGAATGAAAGGGTGCTGCAGG + Intronic
934023044 2:87974387-87974409 TTTGAATGAAAGGGTGCTGCAGG - Intergenic
936413499 2:112281926-112281948 TTTGAATGAAAGGGTGCTGCAGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941264165 2:163338701-163338723 GATCACTGAAAGGATGCAGCTGG + Intergenic
943487759 2:188508655-188508677 GTAGGCTGAAAGGAATCTGCTGG - Intronic
943552865 2:189362416-189362438 CTGGGCTGACAGAATGCTGCTGG - Intergenic
943649384 2:190440892-190440914 GTTTCCTGATGGGATGCTGCAGG + Intronic
944426898 2:199592920-199592942 GCTTTCTGAAAGGATACTGCTGG + Intergenic
946016114 2:216605480-216605502 GCAGGCTGAAATGAAGCTGCAGG - Intergenic
947566305 2:231196138-231196160 GTTGATTGGAAGGATGCTGGAGG + Intergenic
948499221 2:238379369-238379391 GCTGGCTGTCAGGATGCTGGTGG + Intronic
1169220321 20:3818837-3818859 GGTGACTGAAGGGAAGCTGCAGG - Intergenic
1170978262 20:21187223-21187245 GATGGCTGAAAGGATTGGGCTGG - Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1172973002 20:38887109-38887131 GATGGATGAATGGATGCTGGTGG + Intronic
1173540559 20:43847909-43847931 CTTTGCAGAAAGGATGCTGGGGG + Intergenic
1175164369 20:57032930-57032952 ATTTGCTGAAAGGTTGCTGGAGG - Intergenic
1177673868 21:24271228-24271250 TTTGTCTGAAAGGCTGTTGCCGG + Intergenic
1178431108 21:32519752-32519774 GGTGGCTGGGAGGAAGCTGCTGG + Intergenic
1179520779 21:41942945-41942967 GTTTCCTGGAAGGATGCTGGGGG - Intronic
1183761314 22:39821375-39821397 GTATGCTGTAAGGATGCTGAAGG - Intronic
1183917193 22:41131068-41131090 GTAGGCAGAAATGATGCTGCCGG + Intronic
1184060392 22:42077881-42077903 GTTGGCTGAGTGGGAGCTGCAGG + Exonic
1184531564 22:45059380-45059402 GGTGGTTGAAAGGCAGCTGCAGG + Intergenic
1184957441 22:47900193-47900215 GTGGGCAGAAATGATGCTCCTGG - Intergenic
1185193412 22:49452975-49452997 GGTGGCTGAATGGATGTTGGTGG + Intronic
1185418716 22:50723304-50723326 GTGGGCTGCATGGATGCTGGCGG + Intergenic
949169107 3:977363-977385 CTTCCTTGAAAGGATGCTGCTGG - Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961542712 3:127610912-127610934 GTTGGCTGAACTGAAGCTCCTGG - Intronic
964238529 3:154563579-154563601 GTTGGAAGAAAGAATGCTGTTGG - Intergenic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
964589805 3:158348366-158348388 GGTGGCTCAAAGGATTATGCTGG + Intronic
966135359 3:176692021-176692043 GTTGCATGTAAAGATGCTGCTGG + Intergenic
966941451 3:184750492-184750514 GTTGGGGGAGAGGCTGCTGCCGG + Intergenic
968281425 3:197479787-197479809 GTTGTTTGAATGGATGCTGGTGG - Intergenic
973638016 4:52877695-52877717 GCTGGGTGGAAGGATGCAGCCGG - Intronic
978370949 4:108029179-108029201 GTTGGCTGAGAGGAGGGAGCAGG - Intronic
981011854 4:139933308-139933330 GTTGGCTCTAAGGATGCTCATGG - Intronic
981056709 4:140370375-140370397 GTTGGCTGATAGGATTGTTCAGG + Intronic
982539242 4:156646753-156646775 CTTGGATTCAAGGATGCTGCGGG + Intergenic
985310504 4:188592690-188592712 GGTGGCTGAGAGAATGCTGTGGG + Intergenic
985519541 5:366977-366999 CTTGGCTGAAAGGATGTTATTGG + Intronic
990815694 5:59782702-59782724 TTTGGCAGAAAGGATGCTGCTGG - Intronic
991405566 5:66297997-66298019 ATTGGCTGAAAGAATGCTTGAGG + Intergenic
992212241 5:74492438-74492460 GCTGGCTGAAAGGACACTGCGGG - Intergenic
993050740 5:82923199-82923221 GCTGGCTGTAAGGAGGCAGCAGG - Intergenic
993306858 5:86284967-86284989 GTTGGCTGAAGGGATGAATCAGG - Intergenic
996409317 5:123139888-123139910 GGTGGTAAAAAGGATGCTGCAGG + Intronic
997283131 5:132660933-132660955 GTTGGCTGAGAGCTGGCTGCTGG - Exonic
997382948 5:133450419-133450441 GATGGCTAAAAGGAAGCAGCAGG - Intronic
1001635343 5:173206099-173206121 GTGGGCTGAAATGAAGATGCTGG - Intergenic
1001832583 5:174802033-174802055 GGTGGCTGAGAGAATGCTGCAGG - Intergenic
1002350303 5:178578396-178578418 CTGGTCTGAAAGGAGGCTGCAGG + Intronic
1002622668 5:180499783-180499805 GATGTCAGAAAGGTTGCTGCTGG + Intronic
1004586135 6:17002381-17002403 TTTGCCTGCAAGGCTGCTGCAGG - Intergenic
1006516476 6:34548409-34548431 GTCTGATGAAAGGGTGCTGCAGG - Intronic
1007216437 6:40243694-40243716 GTTTGCTGTAAGGATACTGATGG + Intergenic
1008630841 6:53361680-53361702 ATTGCCTGCAAGGATGCTGGAGG + Intergenic
1011734649 6:90298127-90298149 GATGGCTGAAAGCAAGCTGAAGG + Intergenic
1015712798 6:136160544-136160566 GGTGGATGAGAGGATGATGCTGG - Intronic
1016906576 6:149156812-149156834 GGTAGCAGAAAGGATGGTGCTGG - Intergenic
1018350632 6:162955705-162955727 TTTGGCAGAAAGGAGGCTGAAGG + Intronic
1018742686 6:166742633-166742655 GTTGCTGGGAAGGATGCTGCAGG - Intronic
1019427671 7:985038-985060 GGTGGCTGACAAGATTCTGCAGG + Exonic
1022737495 7:33089740-33089762 GTTAGATGAAAAGATGCTGAGGG + Intergenic
1023563854 7:41504243-41504265 GTTGGCTTAAGAGATTCTGCAGG - Intergenic
1026338868 7:69418575-69418597 CTTGGTAGAAAGGTTGCTGCAGG - Intergenic
1026676457 7:72432525-72432547 GTTGGCTGAAAGAAAGCTCAGGG + Intronic
1028573044 7:92313701-92313723 GTTGTCAGAACTGATGCTGCAGG - Intronic
1029273459 7:99390886-99390908 GTAGGCTGAAAAGATCCTACCGG - Exonic
1033786348 7:144735853-144735875 GTTGGCTGAAAAACTGCTGCAGG - Intronic
1034865512 7:154638189-154638211 CTTGCCTGAGAGGAGGCTGCAGG - Intronic
1036031773 8:4981765-4981787 GTTGGTTGAAAGGAAGCCACGGG - Intronic
1036602503 8:10274757-10274779 GATGGCTGAATGGATGATGGTGG - Intronic
1037432134 8:18824857-18824879 CTTGACTAAAAGGATGATGCTGG - Intronic
1038268235 8:26052208-26052230 GGTGGCTGACTGGAGGCTGCGGG + Intergenic
1039192537 8:34993390-34993412 ATTGGTTGCAAGTATGCTGCTGG + Intergenic
1039386244 8:37138173-37138195 GTTGGGGGAAAGGAGGGTGCAGG + Intergenic
1039848395 8:41342345-41342367 GTGGCCTGAAAGGAGGCAGCCGG - Intergenic
1039880262 8:41621190-41621212 GTGGTCTAAACGGATGCTGCTGG + Exonic
1043372291 8:79609472-79609494 GCTGACTGATAGGATGCTACTGG - Intergenic
1044024451 8:87151212-87151234 ATTGGGTCAAAGGATGCTCCTGG - Intronic
1048314528 8:133352339-133352361 TTTGGCTGAAAGGCTTCTGCTGG - Intergenic
1048816995 8:138343490-138343512 GATGGCTGAACTGAAGCTGCAGG + Intronic
1049258782 8:141627765-141627787 GTTTGATGAAAGGAGGCTCCAGG + Intergenic
1050740622 9:8815425-8815447 GTTGCCTGAAATGACCCTGCTGG - Intronic
1052877105 9:33575489-33575511 GTTGGATGAGAAGATGCTGCTGG - Intergenic
1053498899 9:38568905-38568927 GTTGGATGACAAGATGCTGCTGG + Intronic
1057678347 9:97153397-97153419 GTTGGATGAGAAGATGCTGCTGG + Intergenic
1059935724 9:119308557-119308579 CTTGGCTAAATGGATGGTGCTGG - Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062564696 9:137158971-137158993 GTTGTCTGACAGGACCCTGCTGG + Intronic
1062664053 9:137657368-137657390 GTTGGCTGCAGGGGTGCAGCAGG + Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1186476104 X:9858866-9858888 GTTGGCTGGAAGCCTGCTGGCGG + Intronic
1187576731 X:20564595-20564617 GTAGGCTGAAAGGGTGCAGGAGG - Intergenic
1192193556 X:69013827-69013849 GGTGGCTGGAAGAATGCAGCTGG + Intergenic
1196427057 X:115581034-115581056 TATGGCTGAAAGGAAACTGCTGG - Intronic
1199971412 X:152864606-152864628 CTCGGCTGAAAGGAGGCTTCCGG - Intronic