ID: 1113437775

View in Genome Browser
Species Human (GRCh38)
Location 13:110306937-110306959
Sequence AACTCACCTTCGCAGCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437764_1113437775 18 Left 1113437764 13:110306896-110306918 CCCAAGCTCGGGGCGGGACGCCG 0: 1
1: 0
2: 0
3: 4
4: 32
Right 1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1113437772_1113437775 -2 Left 1113437772 13:110306916-110306938 CCGGGAGCGGAGCTGGCCGGGAA 0: 1
1: 0
2: 0
3: 21
4: 200
Right 1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1113437758_1113437775 30 Left 1113437758 13:110306884-110306906 CCTCTCGGGGCGCCCAAGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 48
Right 1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 61
1113437765_1113437775 17 Left 1113437765 13:110306897-110306919 CCAAGCTCGGGGCGGGACGCCGG 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437775 Original CRISPR AACTCACCTTCGCAGCGGCC CGG Exonic
901146055 1:7065320-7065342 ATCTCAGCTTCTCAGTGGCCAGG - Intronic
913658200 1:120981898-120981920 AACACACCTTGGCAATGGCCTGG - Intergenic
914009555 1:143764967-143764989 AACACACCTTGGCAATGGCCTGG - Intergenic
914522768 1:148433163-148433185 AACACACCTTGGCAATGGCCTGG - Intergenic
914648179 1:149673642-149673664 AACACACCTTGGCAATGGCCTGG - Intergenic
918103534 1:181397307-181397329 AACTCACCGAGGCAGGGGCCTGG - Intergenic
924351102 1:243115499-243115521 AACTCCCCTTCACAGCAGACTGG + Intergenic
1062929823 10:1345319-1345341 ACCTCACCTGCGGAGCAGCCAGG - Intronic
1063161577 10:3422467-3422489 AACACTCCTTGACAGCGGCCAGG - Intergenic
1065844715 10:29735540-29735562 AGCGCCCCGTCGCAGCGGCCCGG + Intronic
1067145467 10:43690496-43690518 AGCTCTCCTGCGCAGCGGCCAGG - Intergenic
1071569871 10:86690989-86691011 AGCCCACCTTCTCAGAGGCCTGG - Intronic
1074427278 10:113362634-113362656 AACCCACCTTCGCAGGGACTGGG + Intergenic
1076523239 10:131094123-131094145 AACTGACCTTCGCAGGCACCGGG + Intronic
1076764841 10:132627391-132627413 GACCCACCTGCTCAGCGGCCAGG - Intronic
1084501943 11:69540240-69540262 AACTCACCCTGGCATTGGCCTGG + Intergenic
1106835033 13:33625198-33625220 AACTCATCTTCTCAGAGGCAAGG + Intergenic
1113437775 13:110306937-110306959 AACTCACCTTCGCAGCGGCCCGG + Exonic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1127123424 15:55790421-55790443 AAAATACCTTCGCAGCGGGCCGG + Intergenic
1138515375 16:57533140-57533162 CATTCTCCTTCCCAGCGGCCTGG + Intronic
1141505859 16:84477975-84477997 TCCTAACCTTTGCAGCGGCCTGG + Exonic
1142017194 16:87755938-87755960 AGCTCACCTTCCCTGCAGCCCGG - Intronic
1142394338 16:89823010-89823032 AACTTACCTTCTCAGCCTCCAGG + Intronic
1146973616 17:37092715-37092737 AACTCACCTTGGGAGCTGCTGGG + Intronic
1147971584 17:44221194-44221216 CACTCACCTGCGGAGCCGCCGGG + Exonic
1157119715 18:44897451-44897473 AACACACCTTCTCATCAGCCCGG - Intronic
1160738674 19:676241-676263 AACTGCCCCCCGCAGCGGCCGGG + Intergenic
1166783816 19:45356030-45356052 AACTCACCTTCTCTGAGCCCAGG - Intronic
930647176 2:53923314-53923336 AACTCACCTTTACAGCAGCGCGG + Exonic
932732188 2:74229229-74229251 AAAACACCTTCGAATCGGCCAGG - Intronic
934031872 2:88055619-88055641 AACTCACCTTCTCTGAGGCAGGG + Exonic
940751106 2:157628451-157628473 AACTGACCTTCGGGGCGGACAGG - Intronic
941046146 2:160677783-160677805 ACCTCTCCTTAGCAGAGGCCTGG - Intergenic
1170939597 20:20837691-20837713 ATCTCCCCTTCGCAGCGATCGGG + Intergenic
1173920835 20:46743671-46743693 AAGTCACATTCACAGGGGCCAGG + Intergenic
951887459 3:27538368-27538390 AACTCACCATCCCAGAAGCCTGG - Intergenic
954276209 3:49543390-49543412 AAATCACCTTCTCAGGGCCCCGG + Intergenic
954380892 3:50218473-50218495 GACTCACCTCCACAGCGGCAAGG - Intronic
961774530 3:129274887-129274909 AACTGAACTTCGAAGCAGCCTGG + Exonic
962931000 3:140035921-140035943 AACTCACCTTCCCAGTTGCTCGG + Intronic
964716926 3:159732399-159732421 AACTCACCTGCACAGCAGCAAGG - Intronic
969206250 4:5648700-5648722 AGCTCACCTTCCCAGTTGCCTGG + Intronic
971024189 4:22571761-22571783 AACTTACCTAGGCAGCTGCCTGG - Intergenic
979250836 4:118565038-118565060 AACTCCCCTTCACAGCAGACTGG - Intergenic
991711707 5:69415155-69415177 CACTTACCTGCGCAGCCGCCAGG - Exonic
998222010 5:140290625-140290647 AAATCACATTAGCAGCAGCCTGG + Intronic
999173205 5:149612965-149612987 AACTCACCTTTGCAGTGGGCAGG + Intronic
1000183350 5:158834677-158834699 AACTCAGCTTCACAGTGGCTGGG - Intronic
1003973322 6:11320161-11320183 AACTCAGCTTGGCAGTGGACTGG - Intronic
1013341531 6:109220514-109220536 AACTCAGCTTCCCAGTGGTCAGG - Intergenic
1015965681 6:138693401-138693423 AACTCCCCTTGGCAGCCCCCGGG + Intergenic
1019453503 7:1112366-1112388 AGCTCACCTGCCCTGCGGCCCGG + Intronic
1029729343 7:102429332-102429354 CGCTCGCCTTCGCAGAGGCCTGG - Intergenic
1032332328 7:130992074-130992096 AACTCACCTCCCCAGCAGCCTGG + Intergenic
1036476975 8:9102438-9102460 AACTCACCTTACTAGCTGCCTGG - Intronic
1040817916 8:51528186-51528208 GAGTCACCTTCTCAGCTGCCAGG - Intronic
1049629382 8:143644454-143644476 TACTGATCTTCGCAGTGGCCCGG + Intronic
1053417704 9:37957078-37957100 ATCTGACCTTCACAGCAGCCTGG - Intronic
1053511110 9:38688311-38688333 AACTCACCTTCCCTGCGGTGAGG - Intergenic
1061792759 9:133067084-133067106 AACCCACCTTCTCAGCCACCTGG - Exonic
1061866969 9:133497256-133497278 AGCTCAGCTTCTCAGAGGCCAGG - Intergenic
1186449018 X:9656547-9656569 AACTCTCCCTCTCAGCTGCCTGG - Intronic
1190946201 X:55096293-55096315 ATCTCACCTCCGCAGCTCCCTGG - Intronic
1195138159 X:101931710-101931732 AACTCACCTTCTCTGAGGCAAGG + Exonic