ID: 1113437971

View in Genome Browser
Species Human (GRCh38)
Location 13:110307656-110307678
Sequence TGCTCCTTGGCCGAGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 191}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437971_1113437987 24 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437971_1113437985 22 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437971_1113437977 -5 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437977 13:110307674-110307696 GAGCACCCACAGGGGCCTAACGG 0: 1
1: 0
2: 1
3: 12
4: 170
1113437971_1113437991 27 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437971_1113437986 23 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437971_1113437990 26 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437971_1113437984 16 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437971_1113437988 25 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437971_1113437983 15 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437971_1113437978 -4 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437978 13:110307675-110307697 AGCACCCACAGGGGCCTAACGGG 0: 1
1: 0
2: 2
3: 18
4: 349
1113437971_1113437979 -1 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437979 13:110307678-110307700 ACCCACAGGGGCCTAACGGGAGG 0: 1
1: 0
2: 1
3: 45
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437971 Original CRISPR TGCTCCTTGGCCGAGGAGCT CGG (reversed) Intronic