ID: 1113437972

View in Genome Browser
Species Human (GRCh38)
Location 13:110307663-110307685
Sequence CTGTGGGTGCTCCTTGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 204}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437972_1113437992 24 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437972_1113437987 17 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437972_1113437983 8 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437972_1113437986 16 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437972_1113437990 19 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437972_1113437985 15 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437972_1113437988 18 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437972_1113437991 20 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437972_1113437984 9 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437972_1113437979 -8 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437979 13:110307678-110307700 ACCCACAGGGGCCTAACGGGAGG 0: 1
1: 0
2: 1
3: 45
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437972 Original CRISPR CTGTGGGTGCTCCTTGGCCG AGG (reversed) Intronic
900268984 1:1777625-1777647 GTGGGGGTGGTCCTTGGCCTGGG + Intronic
900401750 1:2475593-2475615 GGGTGGGTCCTCCTTGGGCGAGG + Intronic
900429831 1:2596304-2596326 CTGTGGGTCCTCGTGGGCCAGGG + Intronic
900430183 1:2597668-2597690 CTGTGGCTGCTCCAGGGCTGGGG - Intronic
900692019 1:3986783-3986805 CTGTGGATGCTCCTGGGGCATGG + Intergenic
903008980 1:20317326-20317348 GTGTGGGTGCTCCTTGGAGGTGG + Intronic
903060087 1:20663349-20663371 GAGTGTGTGCTCCTTGGCCCAGG + Intergenic
903135274 1:21305555-21305577 CTGTGAGTCCTTCTTGGCCCCGG - Intronic
905647129 1:39632779-39632801 CTGTGGCTCCTCCTGGCCCGAGG - Intronic
909203695 1:72725795-72725817 GGGTGCGTGCTCCTTGGCTGTGG - Intergenic
911862731 1:102974080-102974102 CTGTGGATGCTGCTGGGCCAGGG + Intronic
912526701 1:110288716-110288738 CCATTGATGCTCCTTGGCCGTGG + Intergenic
918514959 1:185353355-185353377 CACTGCCTGCTCCTTGGCCGAGG + Intergenic
919788148 1:201273313-201273335 CTCTGGGCATTCCTTGGCCGTGG + Intergenic
919926989 1:202196726-202196748 CTATGGGTGCTCCATGGAGGTGG + Intronic
921180021 1:212624815-212624837 CTCTGGGTCTTCCTTGGCCTCGG - Exonic
921532811 1:216306725-216306747 ATGTGGGTGCTCCCTGGATGTGG + Intronic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
1065188647 10:23192140-23192162 CTTTGGGAGCTCCTGGGGCGAGG - Intergenic
1069618160 10:69819487-69819509 CTGTGGGAGCTCCGTAGCTGGGG + Intronic
1073350509 10:102816405-102816427 CTGTGGTTTCTCTTTGGCCCAGG - Intergenic
1075398802 10:122146850-122146872 CTGTAGGTGCCTCTTGGCTGTGG + Intronic
1076465840 10:130681245-130681267 CTGTGGGGCCTCATTGGCCTGGG - Intergenic
1076513315 10:131027561-131027583 CTGTGGGTGGTGCTTGGCCAGGG - Intergenic
1076796046 10:132798982-132799004 CTGTGGGGCCTCCTTGGAAGAGG + Intergenic
1076806108 10:132859656-132859678 CTGTGGCTGCTCCGGGGCGGCGG - Intronic
1076830796 10:132993237-132993259 CTGAGGGTCCCCCATGGCCGTGG + Intergenic
1076875664 10:133214433-133214455 TGGTGGGTGATCCTTGGCTGTGG + Intronic
1076948363 10:133666181-133666203 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076949352 10:133669491-133669513 GTGTGGCTCCTCCGTGGCCGGGG - Intronic
1076950336 10:133672790-133672812 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076951321 10:133676089-133676111 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076952311 10:133679399-133679421 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076953299 10:133682709-133682731 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076955267 10:133742360-133742382 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076956257 10:133745670-133745692 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076957245 10:133748979-133749001 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076958234 10:133752289-133752311 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076959218 10:133755588-133755610 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1076960207 10:133758898-133758920 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
1077078162 11:710512-710534 CTGAGGGTGCTCCCTGGGGGCGG - Intronic
1077220602 11:1413814-1413836 CTGGGGCTGCTCCTTGGCTCTGG - Intronic
1077539550 11:3140093-3140115 CAGAGGGAGCTCCTTGGCAGAGG - Intronic
1077546130 11:3170820-3170842 CTGTGGCTCCTCCCTGGGCGGGG - Intergenic
1077547649 11:3182480-3182502 CTCTGTGTGCTCCTTGCCAGAGG + Intergenic
1077548257 11:3186343-3186365 CTCTGTGTGCTCCTTGCCAGAGG + Intergenic
1079005988 11:16791325-16791347 GTGTGAGTGCTCCTTGGCTGAGG - Intronic
1079368581 11:19830995-19831017 CTGTGGGTGCACCTTTGCAGTGG + Intronic
1081846552 11:46244820-46244842 CTGTGGGTCCTCCTTGGATAGGG - Intergenic
1084043281 11:66555051-66555073 TGGGGGGTGCTCCTGGGCCGAGG + Intronic
1091317702 11:134626088-134626110 ATGTGGGTGGTCCTAGGCCTGGG + Intergenic
1101186850 12:102289528-102289550 CTCTGGCTGCCCCTTGGCAGAGG + Intergenic
1102581226 12:113889352-113889374 CTGTGGGTTCTCCTTGCCTGTGG - Intronic
1105851263 13:24338843-24338865 CTGGGGCTGCCCCTAGGCCGGGG + Intergenic
1107396771 13:40026170-40026192 CTGTGGCTGCTCCATGTCAGTGG + Intergenic
1113200790 13:107866375-107866397 CTGCTGGTGCTCCTTGTCCCGGG + Exonic
1113437972 13:110307663-110307685 CTGTGGGTGCTCCTTGGCCGAGG - Intronic
1113598127 13:111548583-111548605 GGCTGGGTGCTCCATGGCCGGGG - Intergenic
1121644177 14:95506641-95506663 CCTTGGGTGCTCCTTAGCTGAGG - Intergenic
1122390041 14:101373868-101373890 CTGTTCGTGCTCCCTGGCGGAGG + Intergenic
1123022688 14:105409078-105409100 CTGTGTTTTCTCCTTGGCAGTGG + Intronic
1124139745 15:27067105-27067127 CTGCGGCTGCACCTTTGCCGTGG + Intronic
1124212100 15:27771483-27771505 TGGGGGGTGCTCCGTGGCCGCGG + Intronic
1124640429 15:31393089-31393111 CTGTGGGTTCTCCTTGGAAAGGG - Intronic
1125767737 15:42146405-42146427 CTGTGGGCTCCCCTTGGCTGCGG - Intronic
1126111938 15:45180330-45180352 CTGTGGGTGCCAGTTGGCCTGGG - Intronic
1127045146 15:55017580-55017602 CTGTTTTTGCTCCGTGGCCGGGG + Intergenic
1127186841 15:56489180-56489202 CTCTGGCTGCTCCTTGTCCCGGG + Intergenic
1130686538 15:86042485-86042507 CAGTGGCTGCTCCTTGGTCCAGG + Intergenic
1132713732 16:1280328-1280350 CTGTGGGAGCTGCTTTGCCATGG - Intergenic
1135404498 16:22188733-22188755 CTGTGGAAGTTCCTTGGCTGTGG + Intronic
1137713897 16:50585939-50585961 CTGTTGGTGTTCCTTGGATGTGG + Intronic
1138250675 16:55499480-55499502 CTGTGGGTGCAGGTTGGCAGGGG + Intronic
1140518987 16:75566226-75566248 CTTTGGGGGCTCCTGGGCTGCGG - Intergenic
1142132459 16:88437287-88437309 CTGGGGGTGCTGCGTGCCCGGGG - Exonic
1142306936 16:89290979-89291001 CTGTGGGTGGTCCCTGGCGCAGG - Intronic
1142887984 17:2925038-2925060 ATGTGAGTGCCCCTTGGCGGTGG + Intronic
1142949805 17:3469740-3469762 CTGTGTTTCCTCCTTGGCCTTGG - Intronic
1143069369 17:4277590-4277612 CTGTGGGTGCCACTTGGCCCAGG - Intronic
1143385839 17:6529988-6530010 CTGTGATGGCTCCTTGGCCCAGG + Intronic
1143455531 17:7065298-7065320 ATGTAGGTGCTCCTAGGCTGGGG + Intergenic
1144135134 17:12288106-12288128 CTGTGGTGGCTCCTTGGACTAGG + Intergenic
1146454505 17:32998434-32998456 CCGGGGGTGCTGCTTGGTCGCGG + Intergenic
1148221113 17:45862869-45862891 CTGTGTGTGCCCCTTGACCCAGG + Intergenic
1148462496 17:47846746-47846768 CTGGGGGTCCCCCTTGGCAGGGG - Exonic
1148835227 17:50462446-50462468 CGGTGGATGCCCCTTTGCCGGGG + Exonic
1151572381 17:74933294-74933316 CTGTGGGTTTTGCTGGGCCGTGG - Intronic
1151812494 17:76452826-76452848 CTCGGGGTGCTCCGAGGCCGGGG - Exonic
1152772706 17:82179970-82179992 CTGTGGGTGATCCTGTGACGGGG + Intronic
1152898051 17:82924994-82925016 CTGTGGCTTCTCGTTGGCCTTGG + Exonic
1155069599 18:22302745-22302767 CTGTGGGAACTCCATGGCAGAGG + Intergenic
1156789016 18:40949555-40949577 CTGTGGGTGCTCCTGGTCTGAGG - Intergenic
1157874584 18:51260479-51260501 CTGGGGGTGCTTCTTGGAAGAGG - Intergenic
1160530116 18:79557604-79557626 CTGGGGCTGCTCCCAGGCCGAGG + Intergenic
1161668348 19:5590369-5590391 CTGGGGGTCCTCCGTGGCCATGG + Exonic
1161684426 19:5695956-5695978 CTCTGGGAGCTCCTGGGCCCGGG - Intronic
1161737851 19:6002562-6002584 CTGTGGGTGGGCTTTGGCCTGGG + Intronic
1161946445 19:7440344-7440366 CCGGGGGTGCTCCTTGAGCGAGG - Exonic
1164512763 19:28911244-28911266 CTGGTGCTGCTCCTTGGCCACGG + Intergenic
1164805508 19:31113259-31113281 CTGTGGGTGGTCCCTGGACACGG + Intergenic
1165271049 19:34707968-34707990 CTGCAGTTGCTCCTTGGCCAAGG - Intergenic
1166975606 19:46603406-46603428 CTGTGGCTCCTCCTTGGCCCGGG + Intronic
1167382479 19:49146544-49146566 CAGTGTGTCCTCCTTGGCCCTGG - Intronic
1168145903 19:54420178-54420200 CTGTGGGTGCTGCCCTGCCGGGG - Intronic
926670767 2:15575026-15575048 TTCTGGGGTCTCCTTGGCCGAGG - Intergenic
928376749 2:30781154-30781176 CTGAAGCTGCTCCTTGGCCCTGG - Intronic
929430190 2:41879868-41879890 CTGTGGGGGCTCCATGACCATGG - Intergenic
929743934 2:44635742-44635764 CTGGGGGTGCTCCTTAGAAGAGG + Intronic
932500751 2:72180713-72180735 CTGTGGGTGGCCCTTTGCAGAGG + Intronic
933420975 2:82044190-82044212 CTTTGGGTGCCCCTAGGCCTGGG - Intergenic
934977044 2:98810077-98810099 CAGTGGGTGATCCTTGGACCAGG - Intronic
936010303 2:108921223-108921245 CTGTGGGCACTCCTAGGCTGGGG + Intronic
936241806 2:110794266-110794288 CTGTGTGTGCTCTCTGGCCCAGG + Intronic
938633470 2:133195965-133195987 TTGTGGGTGCTGGGTGGCCGGGG - Intronic
944595687 2:201258507-201258529 CTCTGGGTGCTGCCTGGCCCAGG + Intronic
945301470 2:208219651-208219673 CTGTGGGCATTCCTTGGCCCAGG + Intergenic
948981894 2:241498758-241498780 CTTCAGGAGCTCCTTGGCCGTGG + Exonic
1171169329 20:23001381-23001403 CTGTGCCTGCTCCTGGGCTGAGG - Intergenic
1172121938 20:32603634-32603656 CTGGGGGTGCTTCCTGGACGAGG - Intronic
1174379807 20:50149304-50149326 CTGTGGGTGCCCCCTGCCCTGGG - Intronic
1174992094 20:55522542-55522564 CTCTGGCTGCCCCTTGGCTGGGG + Intergenic
1175849989 20:62085119-62085141 CCCTGGGCGCTCCTTGGCTGGGG - Intergenic
1175901572 20:62361881-62361903 CTCTGGGCTCTCCTTGGCCTTGG - Intronic
1175953858 20:62597997-62598019 CTGTGGGTGCTGCCCAGCCGTGG - Intergenic
1176127503 20:63482526-63482548 CTGTGGGGGCTCCGAGGCAGGGG - Intergenic
1178306532 21:31495496-31495518 CTGTGGAGGCTCCTCTGCCGTGG - Intronic
1179884122 21:44306218-44306240 GTGTGGGGGCTCCGTGGCAGAGG + Intronic
1180834570 22:18923421-18923443 CTGTGGGGGCTGCTTGGCAGGGG - Intronic
1180881045 22:19203696-19203718 CTGTGGGTGCTGCCTGTCCCTGG + Intronic
1181065321 22:20303090-20303112 CTGTGGGGGCTGCTCGGCAGGGG + Intergenic
1181316025 22:21971339-21971361 CTGTGAGGGCACCATGGCCGGGG + Intronic
1181363125 22:22354103-22354125 CTGAGGCTGCTCCTTGGCCATGG + Intergenic
1181365936 22:22377179-22377201 CAGAGGCTGCTCCTTGGCCATGG + Intergenic
1181372374 22:22428704-22428726 CAGAGGCTGCTCCTTGGCCACGG + Intergenic
1181427213 22:22851491-22851513 CTGTGGGTGGTCTTTGGGCACGG - Intronic
1182692515 22:32173930-32173952 CTGTGGGAGCTCCTCTGCAGCGG + Intergenic
1184745767 22:46454833-46454855 CCGTGGGTGCTCCTTCGCTGAGG - Intronic
1203284659 22_KI270734v1_random:148720-148742 CTGTGGGGGCTGCTTGGCAGGGG - Intergenic
951520198 3:23604304-23604326 CTCTGGGAGCTCCTAGGCTGTGG - Intergenic
951745370 3:25972073-25972095 CTGTGGGTGCTGTTTGCCAGTGG + Intergenic
952823700 3:37507035-37507057 CTGTGGATCCTCCTGGGCAGAGG + Intronic
954529196 3:51303924-51303946 CTCTGGCTGCCCCTTGGCAGAGG + Intronic
957107110 3:75904373-75904395 CTGTCTGTACTCCTTGGCCAAGG - Intergenic
963064981 3:141256444-141256466 CTGTGGGTGTTTCTTTGCTGGGG - Intronic
964201248 3:154121478-154121500 TAGTGGGTGCTCCTCGGCCCCGG + Intronic
967875338 3:194265035-194265057 CAGTGTGTGCTCCCTGGCCCGGG + Intergenic
968502705 4:958447-958469 CTGTGGGTCGTCCTGGCCCGTGG - Exonic
968562110 4:1289632-1289654 CTGGGGATGCTCCTGGCCCGGGG - Intergenic
968566999 4:1318286-1318308 CTGTGGGTGCCCCTGGCCCCAGG + Intronic
969043899 4:4322678-4322700 CTGTGGACCCTCCTTGGCCATGG + Intergenic
970184196 4:13431671-13431693 CTGTGTGGGCTCCTTGGTTGTGG - Intronic
974009292 4:56592679-56592701 TTGGGGCTGCTCCTGGGCCGCGG + Intronic
974913194 4:68148376-68148398 CTCTGGCTGCCCCTTGGCAGAGG + Intergenic
979649543 4:123114397-123114419 CTGTGGGTGCTCCTTGGCACGGG - Intronic
982372340 4:154647495-154647517 CTCTGGCTGCCCCTTGGCAGAGG - Intronic
983774862 4:171594549-171594571 CTCTGGCTGCCCCTTGGCGGAGG + Intergenic
985453793 4:190073570-190073592 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
985457740 4:190086750-190086772 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
985458728 4:190090047-190090069 GTGTGGCTCCTCCGTGGCCGGGG - Intergenic
985482956 5:128854-128876 CTTTGGGATCTCCTTGGCCAAGG - Intergenic
986011850 5:3724238-3724260 CTCTGGCTGCCCCTTGGCGGAGG + Intergenic
995106400 5:108381560-108381582 CTGAGGGGGCACCTTGGCTGGGG + Exonic
995169573 5:109091498-109091520 CTGTGGTGGCTCTTTGCCCGCGG - Intronic
995527730 5:113064036-113064058 CTGTGGGGGAGCCTTTGCCGTGG - Exonic
999113587 5:149142246-149142268 CTTTCCGTGCTCCTTGGCAGAGG + Intronic
999378598 5:151104314-151104336 CTGTGCCTGCTCCTTGGGCCCGG - Intronic
1003653248 6:7981706-7981728 CTGTGATTTCTCCTTGGCCCAGG + Intronic
1003868516 6:10383708-10383730 CTGTGGGGGATCCTGGGCCGAGG + Intergenic
1005923092 6:30417919-30417941 CTGTGGGTGCCTCCTGGACGGGG - Intergenic
1007958493 6:45938201-45938223 CTGTGTGAGCTCCATGGCTGTGG - Intronic
1013453751 6:110310986-110311008 CAGTGTGTGCTCCTTGTCCCAGG - Intronic
1013932025 6:115545611-115545633 CTGTGGCTGCACCTTGGCAGAGG - Intergenic
1014422354 6:121261266-121261288 CTTTGACTGCTCCTTGGCAGAGG - Intronic
1018800563 6:167219082-167219104 CTCTGGGTTCTCCTTGGCCGAGG - Intergenic
1018809599 6:167288262-167288284 CTCTGGGTTCTCCTTGGCCGAGG + Intronic
1019213381 6:170423981-170424003 CTGTTTGTGCTCCCGGGCCGGGG - Intergenic
1019298561 7:291334-291356 CCGGGGGTGCTCCTTCCCCGGGG - Intergenic
1019658641 7:2211291-2211313 CTGGGGGTGCTGCCTGGGCGTGG - Intronic
1023148583 7:37178020-37178042 ATCTGGGTGTTCCTTGGCCCAGG - Intronic
1024859678 7:53823895-53823917 CTCTGGCTGCTGCTTGGCAGAGG - Intergenic
1027514993 7:79130494-79130516 GCGTGGGTGCTTCTTAGCCGCGG - Intronic
1028523046 7:91753058-91753080 CTCTGGCTGCCCCTTGGCAGAGG - Intronic
1040005917 8:42620862-42620884 CCGTGTGCGCTCCTTGGACGTGG + Intergenic
1041107537 8:54457916-54457938 CTGCGGGCGCCCCTGGGCCGCGG - Exonic
1044828096 8:96217954-96217976 ATGTTGGTAATCCTTGGCCGGGG + Intergenic
1049819282 8:144624767-144624789 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819296 8:144624818-144624840 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819324 8:144624920-144624942 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819338 8:144624971-144624993 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819380 8:144625124-144625146 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819394 8:144625175-144625197 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819408 8:144625226-144625248 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819422 8:144625277-144625299 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819436 8:144625328-144625350 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819450 8:144625379-144625401 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819488 8:144625532-144625554 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819528 8:144625685-144625707 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819554 8:144625787-144625809 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819606 8:144625991-144626013 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819620 8:144626042-144626064 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819646 8:144626144-144626166 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819698 8:144626348-144626370 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819712 8:144626399-144626421 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819726 8:144626450-144626472 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819752 8:144626552-144626574 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1049819766 8:144626603-144626625 CAGTGGGTGCTCCGTGAACGGGG - Intergenic
1055593889 9:77846297-77846319 CTGTGGCTGCCCCTTGGGAGGGG + Intronic
1057077194 9:92144179-92144201 CTGTGGGTGCTCCGTGGAGGTGG + Intergenic
1062385729 9:136310810-136310832 CTGTGGCCTCTCCTTGGCGGGGG - Intergenic
1062479035 9:136743036-136743058 CTGGGGGTGGTCCCTGGGCGGGG - Intronic
1062571244 9:137186368-137186390 CTCTGGGTGCCCCATGGCCAGGG - Intronic
1185431351 X:13672-13694 CTGTGGGTGGTCCTTAGGGGAGG - Intergenic
1185440589 X:226003-226025 CTGTGGGTGGTCCTTAGGGGAGG - Intergenic
1185440641 X:226133-226155 CTGTGGGTGGTCCTTAGGGGAGG - Intergenic
1186618650 X:11215066-11215088 CTGGGGCTGCTCCTGGGCCCTGG - Intronic
1186740953 X:12517715-12517737 CTCTGGCTGCCCCTTGGCAGAGG + Intronic
1188669836 X:32868882-32868904 CTCTGGCTGCCCCTTGGTCGAGG - Intronic
1190157348 X:48004653-48004675 CTGTAGGGCCTCCTTGGCCAGGG + Intronic
1190173118 X:48127538-48127560 CTGTAGGGCCTCCTTGGCCAGGG + Intergenic
1190927186 X:54920911-54920933 CTGTGGGGGCTTCCTGGCTGCGG + Intronic
1197356771 X:125445094-125445116 CTCTGGCTGCCCCTTGGCAGAGG - Intergenic
1199564394 X:149199186-149199208 CTCTGGTTACTCCTTGGCAGAGG + Intergenic
1200086584 X:153610178-153610200 CTTTTGGAGCGCCTTGGCCGGGG - Intergenic