ID: 1113437976

View in Genome Browser
Species Human (GRCh38)
Location 13:110307669-110307691
Sequence AGGCCCCTGTGGGTGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 286}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437976_1113437987 11 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437976_1113437994 26 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437976_1113437983 2 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437976_1113437991 14 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437976_1113437986 10 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437976_1113437992 18 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437976_1113437990 13 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437976_1113437984 3 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437976_1113437988 12 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437976_1113437985 9 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437976 Original CRISPR AGGCCCCTGTGGGTGCTCCT TGG (reversed) Intronic
900140844 1:1139018-1139040 ATGCCTCTGTGGGTGGTCCTGGG - Intergenic
900238562 1:1604003-1604025 ACGCCACTGTGGATGCTCTTGGG - Intergenic
900620148 1:3583057-3583079 AGAGACCTGTGGATGCTCCTTGG + Intronic
900692014 1:3986777-3986799 TCGCCCCTGTGGATGCTCCTGGG + Intergenic
900953804 1:5874695-5874717 AGCCTCCTGTGGGTCCTCCTGGG - Intronic
900981736 1:6049660-6049682 AGCTCCCTGTAGGGGCTCCTCGG + Intronic
901207202 1:7504004-7504026 AGGCCCCTCTGGCTGCCCTTTGG - Intronic
901454298 1:9354331-9354353 AGGAGCCTGTGGGGGCGCCTGGG - Intronic
901743518 1:11357578-11357600 CGGCCACTGTGGGTGCTCAGGGG + Intergenic
903008976 1:20317320-20317342 GGCCCAGTGTGGGTGCTCCTTGG + Intronic
903669797 1:25028620-25028642 TGGGCCCTTTGGGTGCCCCTAGG + Intergenic
906419762 1:45655455-45655477 AGGCACCTGTGGGTACCCTTAGG - Intronic
907314590 1:53560359-53560381 AGGCCCAGGTGGGTGTTACTGGG - Intronic
907455327 1:54571942-54571964 AGGCCCCAGCGGCTGCTCCAGGG - Intronic
910763839 1:90761319-90761341 GGGCAGCTGTGTGTGCTCCTGGG - Intergenic
912108190 1:106306821-106306843 AGCCCCCTGTTGGTGCGCATGGG - Intergenic
915444364 1:155966525-155966547 ATGCCTCTGGGGGTGATCCTTGG - Intronic
920760610 1:208780589-208780611 AGACCACTTTGGGTGCTTCTTGG - Intergenic
921154138 1:212425488-212425510 AGGTCCCTGGGGGTGCTAATTGG + Intergenic
924620543 1:245656590-245656612 AGCCCCCTGTGGGTGCCCAAGGG - Intronic
1063124811 10:3128727-3128749 AGGCCCACCTGGGTACTCCTAGG + Intronic
1063692058 10:8296588-8296610 AGGCCCTGCTGGGTGCCCCTCGG - Intergenic
1064019700 10:11799288-11799310 AGCCCCCTGGGGCTGCTTCTTGG - Intergenic
1066204989 10:33180233-33180255 AGTGCCCTGGGGGTCCTCCTGGG - Exonic
1067085055 10:43233857-43233879 AGTCCCCTGTGGGGGATGCTTGG - Intronic
1070536935 10:77386072-77386094 AGTGCCCAGTGAGTGCTCCTTGG - Intronic
1070688830 10:78509799-78509821 AGGCCCCTGCACTTGCTCCTGGG - Intergenic
1071601066 10:86958960-86958982 AGGGCATTGTGGGTGCTCCAGGG - Intronic
1071744407 10:88399787-88399809 AGCTCCCTGTGGTTGCTACTTGG + Intronic
1075322778 10:121505590-121505612 AGGTAAATGTGGGTGCTCCTGGG + Intronic
1076698087 10:132256726-132256748 CTGCCCCTGTGGGTGGTCCTGGG - Intronic
1076876507 10:133218946-133218968 AGTCCCCTGTGCGTCCCCCTCGG + Exonic
1077002780 11:332925-332947 AAGCCCCTGTCCCTGCTCCTTGG + Intergenic
1077158534 11:1102237-1102259 GGGCCACTGTGGGTGCGCCAGGG + Intergenic
1077181347 11:1218618-1218640 AGGACCCAGTTGGGGCTCCTTGG + Intergenic
1077220606 11:1413820-1413842 CAGCCCCTGGGGCTGCTCCTTGG - Intronic
1077256251 11:1584757-1584779 TGGCTCCTGTGGGTGCTCCAAGG - Exonic
1077256290 11:1584931-1584953 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077258041 11:1597965-1597987 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077258053 11:1597995-1598017 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077259482 11:1608193-1608215 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077261161 11:1621769-1621791 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1077261195 11:1621859-1621881 TGGCTCCTGTGGGGGCTCCAAGG - Exonic
1078083813 11:8221855-8221877 AGGCCCCTGTGGCCTCTTCTTGG + Intergenic
1078339616 11:10489405-10489427 GGGCCCCAGTGGGTGTTCCTGGG + Intronic
1081776079 11:45676825-45676847 AGGCCCCTGGGCCTGCTCCATGG + Intergenic
1082271160 11:50170526-50170548 CGGCACCTGTGGTTGCACCTCGG + Intergenic
1083221986 11:61258696-61258718 AGCCCCCAGTGGGGGCTTCTCGG - Exonic
1083274336 11:61588179-61588201 AGGCCTCTGGGGGAGCTGCTGGG + Intergenic
1083625183 11:64068773-64068795 ATGCCCATGGGGGTGCTCCCAGG - Intronic
1083857406 11:65400004-65400026 TAGCCCCTGAGGGTGATCCTGGG + Intronic
1084083887 11:66845929-66845951 CCGCCTCTGTGGGTGCTCCAAGG - Exonic
1084461461 11:69298836-69298858 GGGCCAGTGAGGGTGCTCCTGGG + Intronic
1084734858 11:71098315-71098337 ACACCCGTGTGTGTGCTCCTAGG + Intronic
1084798790 11:71527471-71527493 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084798800 11:71527501-71527523 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800121 11:71538205-71538227 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800134 11:71538235-71538257 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084800145 11:71538265-71538287 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084801794 11:71548843-71548865 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084803894 11:71565779-71565801 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1084803927 11:71565869-71565891 TGGCTCCTGTGGGGGCTCCAAGG + Exonic
1085289722 11:75389167-75389189 AGGCCCTTGCAGCTGCTCCTGGG + Intergenic
1085344730 11:75761207-75761229 AGGTCCCTGTGGCAGCCCCTGGG - Intronic
1085505467 11:77056313-77056335 AGGACCCTGTGGAAGCACCTAGG + Intergenic
1087868821 11:103266366-103266388 GGGCCCCTGTGGGTGCAGGTGGG + Intronic
1088510235 11:110566189-110566211 TGGCCTCTGTGGGTGTCCCTGGG + Intergenic
1089202778 11:116734505-116734527 AGGCTCCTGTGGCTGGGCCTAGG + Intergenic
1089466044 11:118687398-118687420 AAGCCCATGAGGTTGCTCCTCGG + Intergenic
1091996546 12:4998245-4998267 ATGCTGCTGTGGCTGCTCCTTGG - Intergenic
1092724854 12:11475121-11475143 TAGCCCCTGTGGCTGCTCCCAGG - Intronic
1094634080 12:32207097-32207119 AGGCCTCTGTCTGTCCTCCTTGG - Intronic
1096678742 12:53241125-53241147 AGTCCCCTGTGGGAGCTGTTTGG + Intergenic
1099433792 12:82619749-82619771 AGGGCGCTGAGTGTGCTCCTGGG + Intergenic
1101150428 12:101877947-101877969 TGGTCCCTGTGCCTGCTCCTGGG - Intronic
1101825401 12:108216605-108216627 AGTCCCCTATGGGTGCATCTTGG - Intronic
1103216824 12:119208097-119208119 AGGCCCCTGTGCATTTTCCTGGG + Intronic
1103397962 12:120622433-120622455 AGGGCCCTGTGGGTCATTCTGGG + Intergenic
1103555684 12:121765084-121765106 AAACCTCTGTGGGTGCTCCCAGG - Intronic
1103710440 12:122908438-122908460 AGGCCCCTCTGGCTGTTCATGGG + Intergenic
1103935638 12:124475055-124475077 TGGCCCCTGTGGGTCTTGCTGGG - Intronic
1103982606 12:124746277-124746299 AGGCCCCTGAGGCTGATTCTGGG - Intergenic
1104063202 12:125285432-125285454 AGGCCCCAGTGAGTAGTCCTGGG + Intronic
1104113042 12:125722016-125722038 AGGTCCCTGACTGTGCTCCTTGG + Intergenic
1106552037 13:30780504-30780526 GAGCCCATGTGGGTGCTCCAGGG - Intergenic
1107637629 13:42408456-42408478 AGGCCCAGGTGAGTGCTCATTGG + Intergenic
1108583317 13:51845874-51845896 AGTCTCCTGTAGGTGCTCCATGG + Intergenic
1110128746 13:71979970-71979992 AAGGCCCTGTGGGGGTTCCTTGG - Intergenic
1110859957 13:80337529-80337551 AGGCCCCTCTGTGTACTCATTGG + Exonic
1112005741 13:95252157-95252179 AGGCCTTTGTGGCTTCTCCTTGG - Intronic
1112035561 13:95493262-95493284 AGGGCCAGGTGGGTGCACCTGGG - Intronic
1113437976 13:110307669-110307691 AGGCCCCTGTGGGTGCTCCTTGG - Intronic
1113522885 13:110953210-110953232 ACGTCCCTATGGGTCCTCCTAGG + Intergenic
1113702490 13:112397611-112397633 ACGTCCCTATGGGTTCTCCTAGG - Intronic
1113870166 13:113554276-113554298 AGGCCCCTGTGGGGGAACCTAGG - Intronic
1114538376 14:23437133-23437155 AGGCCTCTGTGGGGGTTGCTTGG + Intergenic
1116532530 14:45990486-45990508 GTGCCCCTGTGGGTGATACTTGG + Intergenic
1117722566 14:58641928-58641950 AGTACCCTTTGGGTGCTACTTGG + Intronic
1119761982 14:77158156-77158178 AGGCCCCTGTGATCTCTCCTTGG - Intronic
1121617362 14:95321429-95321451 AGGCCCCATTAGGGGCTCCTTGG + Intergenic
1122143625 14:99676344-99676366 CAGTCCTTGTGGGTGCTCCTGGG + Exonic
1122814651 14:104306557-104306579 CAGCCCCTCTGGGGGCTCCTGGG + Intergenic
1122835653 14:104429627-104429649 CAGCCCCCGTGGGTGCTCCCTGG + Intergenic
1122857292 14:104565968-104565990 AGACCCCTGTGGGTGGTCGGAGG - Intronic
1123696451 15:22882271-22882293 AGGACGCTGTCTGTGCTCCTGGG + Intronic
1124373033 15:29114228-29114250 AGGCTGCTGGGGGTGCTCCCTGG + Intronic
1124640432 15:31393095-31393117 AAGCCGCTGTGGGTTCTCCTTGG - Intronic
1124657717 15:31522742-31522764 TGGCCACTGTGAGTCCTCCTGGG + Intronic
1124688907 15:31805328-31805350 AGGCTCCTGTAGATGCACCTTGG + Intronic
1125729872 15:41887028-41887050 AGGCCCTTGTGAGTGTTCCAGGG - Intronic
1127723683 15:61726855-61726877 AGCTCCCCGAGGGTGCTCCTGGG + Intergenic
1127726841 15:61758782-61758804 AGCCCCCTGTTGGTGCTCTCTGG - Intergenic
1128251378 15:66166393-66166415 AGGCCAGTGGGGGTGCTCCTGGG - Intronic
1128268662 15:66290055-66290077 AATCCACTGTGGATGCTCCTGGG + Intergenic
1128719875 15:69940485-69940507 AAGCCCCTCTGGGGGCCCCTTGG + Intergenic
1129296784 15:74604233-74604255 AGCCCACTGTGGCTTCTCCTGGG - Intronic
1129365548 15:75051821-75051843 AGGCTGCTGTGGATGCTGCTGGG + Intronic
1132806994 16:1779438-1779460 GGTCCCCTGTGGCTTCTCCTGGG - Intronic
1132986142 16:2768649-2768671 AGGCCCCTGTGAGTGCAGGTTGG - Intronic
1133304616 16:4801492-4801514 AGGCAGCTGTGGGTGAGCCTGGG - Exonic
1133864240 16:9626884-9626906 AGGCCCCTGTGAGTGCCCAGTGG - Intergenic
1134339554 16:13332734-13332756 AGGCTCCTGAGAGTCCTCCTGGG - Intergenic
1136012291 16:27371747-27371769 AGCCCTCAATGGGTGCTCCTTGG - Intergenic
1136239119 16:28933318-28933340 AGGCCCCTTGGGGTGCACATGGG - Exonic
1137831391 16:51546500-51546522 AAGCCTCTGTGGGAGCTCCCTGG - Intergenic
1139289409 16:65844012-65844034 AAGCCCCAGTGGGTGCCCCTGGG + Intergenic
1140518991 16:75566232-75566254 GGACCCCTTTGGGGGCTCCTGGG - Intergenic
1142033973 16:87852399-87852421 AGGCCCCTGTGGCCCCTCCCAGG - Intronic
1142592631 17:1013012-1013034 CCGGCCCTGTGGCTGCTCCTGGG - Intronic
1142856167 17:2731533-2731555 AGGCCCCTGAAGGCGCTGCTGGG - Intergenic
1142883216 17:2896866-2896888 AGGACCCTGTGGCTGCACGTGGG - Intronic
1143028292 17:3953562-3953584 AGGCTCAGGTGGGTGATCCTGGG + Intronic
1144140505 17:12342756-12342778 AGGCTCCTGTGGGTGAACCCAGG + Intergenic
1145104825 17:20106213-20106235 AGGCACCTGAGTGTGCTTCTTGG + Intronic
1146275293 17:31512432-31512454 AGGCCCCTGGGGGTGGGCTTGGG - Intronic
1148859536 17:50596816-50596838 AGGCCCGTGCTGGTGCTCTTGGG - Exonic
1149982695 17:61323849-61323871 TGGCCCCTGTGTGGGTTCCTTGG + Intronic
1151382411 17:73734945-73734967 AGGCCTCTGTGCCTGGTCCTGGG + Intergenic
1151476873 17:74349122-74349144 AGGCCTCGGTGAGTGCACCTGGG + Intronic
1151703258 17:75754231-75754253 AGGCCCCTGAGGGGTCTACTTGG - Intronic
1151718181 17:75842188-75842210 AGGCCCTTGTGGGTGAGTCTGGG - Intronic
1151869344 17:76826030-76826052 AGGGGGCTGTGGGTGCCCCTGGG - Intergenic
1152597827 17:81246489-81246511 AGGCCCCTCAGAGTGCTCCAGGG + Exonic
1152749852 17:82057614-82057636 AGGCCACAGTGGCTGCTGCTGGG - Intronic
1152904435 17:82962571-82962593 AGGTTCCTGTGGGTGCTGGTGGG + Intronic
1153954307 18:10083264-10083286 GGGGCCCTGTGGGTGCTCCCTGG + Intergenic
1157815151 18:50724789-50724811 AGGCCCACGAGGGAGCTCCTCGG + Intronic
1161221570 19:3120402-3120424 AGGCCCCTGGGGGTGTTCAAGGG - Intronic
1163696735 19:18768122-18768144 CAGCCCCTGTGGGTGCTGCGGGG - Intronic
1163715254 19:18869373-18869395 AGGCCCGGGTGGGCGCACCTGGG + Exonic
1163848751 19:19651886-19651908 AGGCCACAGTGGGAGATCCTGGG + Intronic
1164560443 19:29288447-29288469 AGCCCCCTGTGTGTGGACCTGGG + Intergenic
1166046907 19:40235222-40235244 AGGTCCCTGAGGGTCCTGCTGGG + Intronic
1166283181 19:41808747-41808769 AGGCCCCTGTGGTTTCCTCTGGG + Intronic
1167499365 19:49836613-49836635 ATCCTCCTGTGTGTGCTCCTGGG + Intronic
1168459493 19:56541464-56541486 AGACCCCTCTGGCTGCTCATCGG - Intronic
925198288 2:1945433-1945455 AGGGCCGTGAGGGAGCTCCTTGG + Intronic
925315424 2:2919292-2919314 AGGCCCCTCTATGTGCACCTGGG + Intergenic
925414477 2:3659815-3659837 AGGCCACTGTGGATACTTCTGGG + Intronic
925631959 2:5903554-5903576 AGGGAGCTGTGGGTGCTCCGAGG + Intergenic
926228039 2:10982286-10982308 TGGGTCCTGTGGGTTCTCCTGGG - Intergenic
927306439 2:21578954-21578976 AGGCCCCTCTCTGAGCTCCTGGG + Intergenic
929555052 2:42920884-42920906 AGGCTCCTGAGGGTGTTTCTTGG + Intergenic
929974212 2:46616608-46616630 AGGCTCCTCTGGGTGCCGCTCGG - Intronic
930780822 2:55223711-55223733 AGGCCCCTGCCGAGGCTCCTGGG - Intronic
932495591 2:72144429-72144451 AGCCTCCTGGGGGTGCCCCTGGG - Intronic
932570020 2:72933721-72933743 AGGCCCCAGTGGCTGCTCTGGGG + Intronic
933709777 2:85316364-85316386 AGGCCCCTGAGTGTGCACCCAGG - Intergenic
933713285 2:85343399-85343421 AGGCCCCTGAGCGTGCACCCAGG + Intronic
934618904 2:95792256-95792278 CGGCCACTGGGGCTGCTCCTTGG - Intergenic
934641989 2:96032301-96032323 CGGCCACTGGGGCTGCTCCTTGG + Exonic
935070411 2:99688980-99689002 AGGACCAGGTGGGTGCTCGTTGG - Intronic
936965694 2:118125732-118125754 AGGACCCTTTGGGTGGTCTTGGG - Intergenic
937982177 2:127622248-127622270 TGGTCCCTGTGAGTGCCCCTGGG + Intronic
938406567 2:131036145-131036167 AGGCCCTTTTTGGTGCTCGTAGG - Intronic
942448505 2:176093624-176093646 GGACCCCTGTGGCTGGTCCTTGG - Exonic
943649651 2:190443142-190443164 AACCCTCTGTGGGTGTTCCTAGG + Intronic
948789598 2:240370425-240370447 AGGCACCCGAGGGTGCTTCTGGG - Intergenic
948804143 2:240446152-240446174 AGGCCACCGTGGGCCCTCCTGGG - Intronic
948854765 2:240724963-240724985 GGCCTCCTGTGGGTGATCCTGGG - Intronic
948980979 2:241494609-241494631 AGGCCCCTGGGGCTGCCACTTGG - Exonic
1169429792 20:5526192-5526214 AGGCCCATGTGTGTCTTCCTGGG + Intergenic
1171180911 20:23089563-23089585 AGGCCCCTGTTTGTGCAGCTCGG + Intergenic
1172841673 20:37905733-37905755 GGGCAGCTGTGGGGGCTCCTCGG - Intronic
1175053540 20:56177250-56177272 AGGCCCATCTGTGTGCTACTGGG - Intergenic
1175597145 20:60244334-60244356 AGATGCCTGTGGGTCCTCCTTGG - Intergenic
1175765930 20:61592973-61592995 AGGACCCTGTGAGTGCACTTAGG - Intronic
1175839917 20:62020196-62020218 AGGCCCCTGTGGATTCTCAGAGG + Intronic
1176137991 20:63533437-63533459 TGGACGCTGTGGGTGCTGCTTGG + Intronic
1176408665 21:6435987-6436009 AGGGCCAGGTGTGTGCTCCTGGG + Intergenic
1177516174 21:22154147-22154169 AGGTCCCTGTGGATGCTCTCAGG + Intergenic
1179280358 21:39928869-39928891 AAGCCCCTGTGTGTGCCCCAAGG + Intronic
1179490067 21:41735425-41735447 GGGCCCCTGTGAGGGATCCTGGG + Intergenic
1179684159 21:43044307-43044329 AGGGCCAGGTGTGTGCTCCTGGG + Intergenic
1179810428 21:43865829-43865851 AGGCCCCTGGGGGGGGTCCCGGG - Intronic
1181047779 22:20223767-20223789 TGGCCCCTGTGCTGGCTCCTGGG + Intergenic
1181309146 22:21934293-21934315 AGGCCCCTGTGGGAGCTGTCAGG - Intronic
1181557661 22:23681219-23681241 GGGCCCCTGATGGTGCTCATGGG + Intergenic
1182500664 22:30744376-30744398 AGGCCACTGTGGGTTATCCCGGG + Intronic
1183489133 22:38107506-38107528 AGGTCCATGTGGCTGCTCCCTGG + Intronic
1184297670 22:43535475-43535497 AGGCTCATGTGGATGCTCCACGG + Intronic
1184565689 22:45290353-45290375 ACGCCCCTGGGGGTGCACATGGG - Intronic
1184711069 22:46249929-46249951 AGGCCCCTGCCGAGGCTCCTGGG + Intronic
1184720282 22:46308705-46308727 GGCCCCCTGTGGGTGAGCCTCGG + Exonic
1184778882 22:46636320-46636342 CGGACCCTGTGGGAGCTGCTTGG - Intronic
950590302 3:13932154-13932176 AGGCGCCTGTGGGAGCTCAGAGG - Intergenic
950665638 3:14493328-14493350 AGGTCTCTGTGGGGCCTCCTTGG - Exonic
950710380 3:14809724-14809746 AGGCGCCTGTGGGAGCTCAGAGG - Intergenic
952763256 3:36934121-36934143 AGGGCCTTGTGTGTGCTCCATGG + Intronic
953381200 3:42474035-42474057 AGGGACGTGGGGGTGCTCCTGGG + Intergenic
953837786 3:46362184-46362206 TGGCCCCTCTGGGTGGCCCTTGG - Intergenic
954100843 3:48371538-48371560 ACGCCCCTCTAGGTGCTTCTTGG + Intergenic
954129613 3:48553669-48553691 AGGGACTTGTGGCTGCTCCTTGG - Intronic
954939017 3:54353858-54353880 AGGCCCCTCAGGGTGATGCTTGG + Intronic
955356221 3:58235517-58235539 AGGCCCCTGGGACTGCTCCCTGG + Intergenic
961487631 3:127227735-127227757 AGGCCACTGTGGCTGCAGCTGGG + Intergenic
961513938 3:127421178-127421200 AGCCTCCTGTAGATGCTCCTGGG - Intergenic
966918743 3:184598906-184598928 AGCCCCCCGTGTGTGCTGCTGGG - Intronic
969227441 4:5808083-5808105 AGGCCCCTCTTGGGGCTCCCAGG + Intronic
969509456 4:7609502-7609524 CAGCCCCTGTGGTTTCTCCTTGG + Intronic
970704979 4:18789902-18789924 AGACCACTCTGGGTGCTTCTGGG + Intergenic
972221982 4:36966488-36966510 AGCCCCCTCAGGGTCCTCCTTGG + Intergenic
972636283 4:40886801-40886823 AGGCCAACCTGGGTGCTCCTGGG + Intronic
972959648 4:44437227-44437249 AGGCTCCTGTGAGTGCTCCTTGG - Intronic
975996437 4:80321456-80321478 AGGCCGTGGTGGGTGCTCTTTGG + Intronic
978025470 4:103867801-103867823 AGACCCCTGTGTGTACCCCTAGG - Intergenic
980102218 4:128553141-128553163 CTGCCCCTGTGTGTACTCCTAGG + Intergenic
981065964 4:140486106-140486128 AGGCCAGTGTGGGTGATGCTGGG - Intronic
982515727 4:156347007-156347029 AAGCCTCTGTTGTTGCTCCTAGG + Intergenic
985937052 5:3105663-3105685 AGCGCCGTGTGGGTGCACCTAGG + Intergenic
988566074 5:32320771-32320793 TGGCACGGGTGGGTGCTCCTAGG + Intergenic
988589708 5:32538223-32538245 AGGCACCTGTGGGTGCCTCCTGG - Intronic
991609311 5:68434361-68434383 AGGCTCCTGTCTGTGCTCCGGGG - Intergenic
993016515 5:82540573-82540595 AGGCCCCTTTGTTTTCTCCTCGG - Intergenic
993375108 5:87141484-87141506 ATGCCCCTTTCTGTGCTCCTGGG - Intergenic
996806041 5:127455050-127455072 AGAGCCCTCTTGGTGCTCCTGGG + Intronic
997475240 5:134138860-134138882 AGGCCCCTGTAGGAGGTTCTAGG + Intronic
998388635 5:141772908-141772930 AGGCCACTGGGTGGGCTCCTTGG + Intergenic
998505381 5:142668029-142668051 AGGCCCCTGGGGGAGGGCCTGGG + Intronic
998617662 5:143758319-143758341 CTGCCCCTGTGTGTGCTGCTCGG - Intergenic
1001711732 5:173784333-173784355 AGGCCCCTGCAGGGACTCCTTGG + Intergenic
1002638295 5:180618829-180618851 AGGACCCTGTCGCTGCTCCCCGG + Exonic
1002641119 5:180631061-180631083 GGGCCCCAGTGGGTGCTCCCAGG + Intronic
1002826066 6:775520-775542 ATGCCCCTCTGCCTGCTCCTGGG + Intergenic
1003864635 6:10351789-10351811 AGGCCCCTGTGGGAGCTCAGTGG + Intergenic
1004065814 6:12242716-12242738 AGGTCCCTCTGGCTCCTCCTTGG + Intergenic
1006030205 6:31172219-31172241 AGGTCCCTGTGGGGGGCCCTTGG - Intronic
1006811730 6:36824553-36824575 AGGCCCCTGTGGGGGGTTGTGGG - Intronic
1007753633 6:44084674-44084696 AGGGCCCTGTGCCTACTCCTGGG - Intergenic
1018952962 6:168391089-168391111 GGGCCCCTGAGGGGGCTCCCGGG - Intergenic
1018992471 6:168684663-168684685 AGGCAGCTGGGAGTGCTCCTGGG - Intergenic
1019266997 7:123329-123351 AGGCCTCCCTGGGTGCTGCTGGG - Intergenic
1019408214 7:895052-895074 AGGCCCCCGTGGCTGCTCCATGG + Intronic
1020452895 7:8340071-8340093 AGGACCCTGTGGGTGTTATTTGG - Intergenic
1021686127 7:23188080-23188102 AGCCCACTCTGGGTGTTCCTGGG + Intronic
1023865106 7:44234768-44234790 AGGACCCTGGGCTTGCTCCTGGG - Intronic
1024275426 7:47673331-47673353 AGGTCCCTTTGGTTTCTCCTGGG - Intergenic
1025651675 7:63475572-63475594 GTGCCCCAGCGGGTGCTCCTTGG - Intergenic
1027530427 7:79323954-79323976 AGCCTCCTGGGGATGCTCCTGGG + Intronic
1028358268 7:89936048-89936070 AGGCCCCTGTGTTTGCTGATTGG + Intergenic
1028611634 7:92718386-92718408 AGGCTTCTGTGGGAGCTACTCGG + Intronic
1029380849 7:100213602-100213624 AGGCCCCTATGGCACCTCCTGGG - Intronic
1032252439 7:130269902-130269924 AGGGACCTGTGGGTGCCACTAGG + Intronic
1033151176 7:138916090-138916112 AGGTCCCTGTAAATGCTCCTTGG - Intronic
1033673507 7:143515232-143515254 ATGACTCTGTGGGTGCTCCATGG - Intergenic
1034281563 7:149858545-149858567 CTGGGCCTGTGGGTGCTCCTGGG - Intronic
1034710336 7:153185575-153185597 AGGCCCCTGTGGCTGCTCTCAGG + Intergenic
1035043205 7:155945892-155945914 AGGTCCCTGCGGAGGCTCCTGGG - Intergenic
1037897886 8:22670242-22670264 AGGCCCGTGCAGGTGCTGCTGGG + Intergenic
1040391530 8:46954767-46954789 AGGACCCCGCGGGTGCTCCGGGG - Intergenic
1040454593 8:47583853-47583875 CGGCCCCTCTGGGAGCTGCTAGG - Intronic
1040491169 8:47923700-47923722 AGGCCTCTGAGTGTCCTCCTAGG - Intronic
1041389270 8:57334615-57334637 AGGCACCTGTAGTTTCTCCTAGG - Intergenic
1044726405 8:95197795-95197817 AGGATCCTGTGGGTGCTTCACGG - Intergenic
1045189626 8:99869925-99869947 AGGCCTATGTGGCTGCTGCTGGG + Intronic
1045655370 8:104381531-104381553 AGGCCCCAGTGAGTGTCCCTGGG - Intronic
1046729685 8:117711704-117711726 TCTCCCCTGTGAGTGCTCCTTGG - Intergenic
1050854380 9:10333277-10333299 AGGCTCCTGTGGTTGTTCCTGGG - Intronic
1053191670 9:36076382-36076404 AAGACCCTTTGGGTGCACCTGGG - Intronic
1054455911 9:65430315-65430337 AGACCCCTCTGGCTGCTGCTGGG - Intergenic
1054748696 9:68882162-68882184 AAGCCCCCATGTGTGCTCCTGGG - Intronic
1056583839 9:87915132-87915154 AGGCCCCGGTGGGAGGCCCTCGG - Intergenic
1056584331 9:87918601-87918623 AGGCCCCGGTGGGAGGCCCTCGG - Intergenic
1056591810 9:87970542-87970564 AGACCCCTGTGGGTGGTCAAAGG - Intronic
1056612538 9:88134321-88134343 AGGCCCCGGTGGGAGGCCCTCGG + Intergenic
1056613030 9:88137789-88137811 AGGCCCCGGTGGGAGGCCCTCGG + Intergenic
1056949279 9:91029111-91029133 AGCCCCCTGTGGGTGATACATGG - Intergenic
1057077190 9:92144173-92144195 TGCCTCCTGTGGGTGCTCCGTGG + Intergenic
1057160118 9:92883216-92883238 AGGCCCCGGTGGGAGGCCCTTGG - Intergenic
1057192163 9:93094369-93094391 AGCCCCCTCTGGGTCCTCCAGGG + Intergenic
1057667885 9:97060935-97060957 AGGCCAGTGTGGGTGCACCAGGG - Intergenic
1058637149 9:107048106-107048128 GGGGACCTGGGGGTGCTCCTTGG - Intergenic
1058678932 9:107424963-107424985 AGGCCAGTGTGGGTGGTCCTAGG + Intergenic
1061184243 9:129042756-129042778 AGGACCCTTTGGGAGCACCTTGG + Intronic
1061256977 9:129459120-129459142 TGGACTCTGTGGGTGCCCCTTGG - Intergenic
1061283340 9:129609603-129609625 AGGGCCCTGTTGGGGCCCCTGGG + Intronic
1061849197 9:133404688-133404710 AGGCCCCTGTGTGAGCTCTGGGG + Intronic
1062068298 9:134540634-134540656 AGGGCCCTGTGGATGGTCCAAGG + Intergenic
1062139967 9:134950555-134950577 AGGCCCCTGAGGTTTCTCCAGGG + Intergenic
1062143005 9:134970059-134970081 AGGCACCTGTGGCTTCTCCTGGG + Intergenic
1203435955 Un_GL000195v1:137599-137621 AGGCCCCAGTGTGTGATCTTTGG - Intergenic
1186618654 X:11215072-11215094 AGGCCCCTGGGGCTGCTCCTGGG - Intronic
1187391563 X:18889626-18889648 AGGCCCCTGAGGAAGCCCCTAGG - Intergenic
1189020932 X:37338925-37338947 AGGCCTCTCTGGGTGATCCTGGG - Intergenic
1189316453 X:40060448-40060470 AGACCCTTGTGGGTGCTCTAAGG - Intronic
1196749847 X:119106147-119106169 AGGCCCCATTGGGAGCTCTTGGG + Intronic
1197723108 X:129758410-129758432 AGGGCCCTGGGGCTTCTCCTTGG - Intronic
1200137171 X:153880782-153880804 AGGTACCTGTGGGGGCTCCCTGG - Intronic