ID: 1113437976

View in Genome Browser
Species Human (GRCh38)
Location 13:110307669-110307691
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 286}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437976_1113437992 18 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437976_1113437994 26 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437976_1113437988 12 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437976_1113437987 11 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437976_1113437990 13 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437976_1113437983 2 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437976_1113437991 14 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437976_1113437984 3 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437976_1113437986 10 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437976_1113437985 9 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437976 Original CRISPR AGGCCCCTGTGGGTGCTCCT TGG (reversed) Intronic