ID: 1113437980

View in Genome Browser
Species Human (GRCh38)
Location 13:110307679-110307701
Sequence GCCTCCCGTTAGGCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 54}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437980_1113437990 3 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437980_1113437994 16 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437980_1113437988 2 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437980_1113437987 1 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437980_1113437991 4 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437980_1113437992 8 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437980_1113437985 -1 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437980_1113437986 0 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437980_1113437983 -8 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437980_1113437984 -7 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437980 Original CRISPR GCCTCCCGTTAGGCCCCTGT GGG (reversed) Intronic
901689032 1:10960624-10960646 GCCTCCCGCTCGGGGCCTGTGGG + Intronic
903687480 1:25142515-25142537 GCCTCCCATTAGTCCCCTGTAGG - Intergenic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
905168945 1:36098779-36098801 GGCTCCCCTTTGGCCCCTGATGG + Exonic
905888505 1:41504845-41504867 CCCTCCTTTTAGGCCACTGTGGG + Intergenic
906323952 1:44832745-44832767 GCCTCCCTATTGGCCCCTATTGG - Intronic
906815307 1:48872838-48872860 CCTTCCTGTTAGGCCCCTGGGGG - Intronic
924223556 1:241902604-241902626 GCCTCCCTTCAGGCTCCTGCAGG + Intergenic
1072708737 10:97701665-97701687 GCCTCTCACTAGGCTCCTGTGGG + Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1084247642 11:67871060-67871082 GCCTCCAGTTAGGCAACTCTGGG + Intergenic
1084413935 11:69019625-69019647 GCTTCCCGCCAGGCCCCTGAGGG - Intergenic
1084643019 11:70437165-70437187 CTCTCACGTTAGGCTCCTGTGGG - Intergenic
1091045317 11:132319838-132319860 GCCTCCCGTTAGGCTACTCGGGG - Intronic
1091654217 12:2333503-2333525 CCTTCCCCTTAGGCCACTGTGGG - Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1104706260 12:130949730-130949752 GCCTCCCCTCCGGCTCCTGTCGG - Intergenic
1105443794 13:20435849-20435871 GCCTCCCGCGAGGGCGCTGTCGG - Intronic
1106511824 13:30419617-30419639 GCCTGACATTAGGCCCCAGTAGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113575402 13:111391722-111391744 GACTCCCCTTAAGCCCCTGCTGG - Intergenic
1116372550 14:44154592-44154614 GGCTCCAGGTTGGCCCCTGTAGG + Intergenic
1117376584 14:55123369-55123391 GCCTCCAGTGAGGCCCCATTTGG + Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1132603563 16:784410-784432 GCCTCCAGTCGGGCCCCGGTGGG + Intergenic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1151747307 17:76018431-76018453 GCCTCCCGGTAGGTCTGTGTAGG - Exonic
1152925852 17:83087452-83087474 GCCTCTCGTGAGGGCCCTGGAGG - Intronic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
936068474 2:109349676-109349698 TCCTCCTGTGAGGCCCCTGGAGG - Intronic
944511456 2:200470104-200470126 ACCTCACGTTAGCCCCCTGGGGG - Intronic
1178918464 21:36722789-36722811 GCCACCCCTGAGGCCCCTGATGG - Intronic
1180850712 22:19018690-19018712 GTCTGCATTTAGGCCCCTGTGGG - Intergenic
1184151785 22:42643730-42643752 GCCTCCTTTAAGGCCCCAGTTGG + Intronic
1184233284 22:43169701-43169723 GCCTCCTGTTTGGACCCTGAGGG - Intronic
954396209 3:50294782-50294804 GCCTTCCGTGTGGCCCTTGTTGG - Exonic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
958167828 3:89900113-89900135 GCCTCCAGTTAGGCTACTTTGGG - Intergenic
961384683 3:126516771-126516793 GTGTCCTGTTAGGCCTCTGTGGG + Intronic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
984718947 4:182952548-182952570 CCCTCTACTTAGGCCCCTGTGGG - Intergenic
1002707198 5:181169979-181170001 GCCTCCTGCTCGGCCCCTGCAGG + Intergenic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1017766800 6:157613585-157613607 GCCACACGATAGGCACCTGTTGG + Intronic
1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG + Intronic
1025145289 7:56496278-56496300 GCCTCCAGGTAGGGCCCTGTTGG + Intergenic
1032128504 7:129211433-129211455 GCCTCCAGTTAGGCCCTTTGGGG + Intronic
1034916266 7:155042319-155042341 GCCTCAAATTAGGCCCCAGTGGG - Intergenic
1039559825 8:38504072-38504094 GCATCCCATTAGGCCTCTGAAGG + Intergenic
1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG + Intergenic
1041027987 8:53706653-53706675 GCCTCCCCTTGGGCCCATGCTGG - Intergenic
1043120760 8:76320129-76320151 GCCTCAAGTTAGTCCCCTCTTGG - Intergenic
1056752559 9:89363012-89363034 GCCTCACCTGAGGCACCTGTTGG - Intronic
1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG + Intronic
1199599542 X:149533767-149533789 GCCTCTCATTAATCCCCTGTGGG - Exonic