ID: 1113437981

View in Genome Browser
Species Human (GRCh38)
Location 13:110307680-110307702
Sequence AGCCTCCCGTTAGGCCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437981_1113437988 1 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437981_1113437991 3 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437981_1113437987 0 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437981_1113437994 15 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437981_1113437986 -1 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1113437981_1113437992 7 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437981_1113437985 -2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437981_1113437983 -9 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437981_1113437984 -8 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437981_1113437990 2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437981 Original CRISPR AGCCTCCCGTTAGGCCCCTG TGG (reversed) Intronic
900887918 1:5428632-5428654 AGCCTCCTGTTCTGCGCCTGAGG + Intergenic
901297277 1:8170276-8170298 CGCCTCCCATTAGCCTCCTGGGG + Intergenic
902820266 1:18939086-18939108 AGCCTCCCTTTTGGCCCTAGAGG - Intronic
905203308 1:36328284-36328306 AGCCTTCAGTTTGGCCACTGGGG - Exonic
906815309 1:48872839-48872861 GCCTTCCTGTTAGGCCCCTGGGG - Intronic
909483333 1:76148709-76148731 GGCCTCCACTGAGGCCCCTGGGG - Intronic
912332796 1:108834844-108834866 AGCCTCCAGGAAGGCCCATGAGG - Intronic
913366753 1:118047811-118047833 AGCCTCCAGGCTGGCCCCTGTGG + Intronic
916741485 1:167650541-167650563 GGCCTCCTGGTAGGCCTCTGGGG - Intronic
917613868 1:176716987-176717009 ACCCTCCCTTTAGGCCCCTTAGG + Intronic
919969974 1:202569555-202569577 AGCCTCCCATTGGGTGCCTGGGG + Intronic
920043830 1:203120892-203120914 AGCCTCTCCTTAGGACCCAGTGG + Intronic
922729692 1:227943084-227943106 AGCCTCCCTCTTGGACCCTGCGG + Intronic
922929341 1:229376703-229376725 AGCCTCCCTCCAGGCCTCTGCGG + Intergenic
1068116162 10:52739872-52739894 AGCCTCTCGTTAGGCAGGTGAGG + Intergenic
1072916040 10:99537721-99537743 AGCCTCCCGCTAGGCCCTTTCGG - Intergenic
1073878368 10:107950927-107950949 AGCTGCCCGTCAGTCCCCTGAGG - Intergenic
1074372636 10:112912761-112912783 AGTCTCCCGTTTGGCTCCGGTGG + Intergenic
1076531725 10:131149395-131149417 AGCCTCCCTGCAGGCCCCAGAGG - Intronic
1080554344 11:33402378-33402400 AGCCTCTACTCAGGCCCCTGTGG + Intergenic
1083334569 11:61915179-61915201 AGCACCCAGCTAGGCCCCTGGGG + Intronic
1084413936 11:69019626-69019648 AGCTTCCCGCCAGGCCCCTGAGG - Intergenic
1084643020 11:70437166-70437188 ACTCTCACGTTAGGCTCCTGTGG - Intergenic
1089475160 11:118753842-118753864 AGCCTCCCTTTAGGAGGCTGAGG + Intronic
1090012981 11:123061834-123061856 AGCCTCCCCTGGGGCCACTGCGG + Intronic
1091045318 11:132319839-132319861 TGCCTCCCGTTAGGCTACTCGGG - Intronic
1091077287 11:132632191-132632213 AGGATCTTGTTAGGCCCCTGAGG + Intronic
1096741221 12:53695556-53695578 AGCCTCCCGGGAGGCCGCAGGGG - Intergenic
1096780494 12:53989029-53989051 AGCCCACCGCCAGGCCCCTGGGG + Intronic
1098134744 12:67390282-67390304 AGCCTCCCCTGAGGCTTCTGGGG + Intergenic
1103393244 12:120589262-120589284 AGCCTCCCTCAAGGACCCTGGGG + Intergenic
1107741464 13:43454908-43454930 AGCCTCCCGTCCAGCCCCTCTGG + Intronic
1107771522 13:43792296-43792318 TGCCTCCCGATGGGCCCCAGAGG + Intergenic
1113434143 13:110276394-110276416 AGCCTCCTGTTAGGCCCCTGGGG + Intronic
1113437981 13:110307680-110307702 AGCCTCCCGTTAGGCCCCTGTGG - Intronic
1122947132 14:105017148-105017170 AGCCTCCAGAGAGGCTCCTGGGG + Intronic
1123837898 15:24214519-24214541 TGCCTCCCTCTAGGCCCCTCAGG + Intergenic
1123886391 15:24731911-24731933 ACACTCCAGTCAGGCCCCTGTGG + Intergenic
1124530292 15:30499757-30499779 GGCCTCCCGTAAGGCAGCTGTGG + Intergenic
1124768367 15:32507931-32507953 GGCCTCCCGTAAGGCAGCTGTGG - Intergenic
1128565904 15:68700277-68700299 AGCTTCCCTCTGGGCCCCTGTGG - Intronic
1130850656 15:87790640-87790662 AGGCTCCCGTGAGTCTCCTGGGG - Intergenic
1132611194 16:817100-817122 AGCCTCCAGAAAGGCCGCTGCGG - Intergenic
1132974014 16:2702649-2702671 AGGCTCCCAGTAAGCCCCTGCGG + Intronic
1136189232 16:28605983-28606005 AGCCTCCCCATAGGCACTTGGGG - Intronic
1136317800 16:29464391-29464413 AGCCTCCCCATAGGCACTTGGGG + Intronic
1136432375 16:30203736-30203758 AGCCTCCCCATAGGCACTTGGGG + Intronic
1137719080 16:50617176-50617198 AGCCTCCCATTGGGCCCATGGGG + Intronic
1138026823 16:53528623-53528645 AGCCTCTTACTAGGCCCCTGTGG - Intergenic
1140760257 16:78103038-78103060 AGCCTGGCGCTAGGGCCCTGGGG + Intronic
1142668281 17:1474892-1474914 AGCCTCCCCGCAGGCCCCTGTGG + Intronic
1146850819 17:36220113-36220135 AGCCTCCCATTTGGCCTGTGTGG + Intronic
1146948251 17:36888703-36888725 ACCCTCCCCTTAAGCCCCTGGGG - Intergenic
1148210475 17:45805643-45805665 AGCCTCCCATGAGGCCTCTTGGG + Intronic
1150442389 17:65202106-65202128 AGCCTTCCCTTGGGCCTCTGAGG + Intronic
1152889795 17:82873985-82874007 AGCCTCCTGTTGGCCCCGTGAGG + Intronic
1163364848 19:16870088-16870110 AGCCTGCCGGGAGGCCCCGGGGG + Intronic
1163432332 19:17275818-17275840 AGCCTCATGTAAGTCCCCTGTGG + Exonic
1163686634 19:18715613-18715635 AGCCTCCCCTCAGCCACCTGTGG + Intronic
1164735565 19:30538613-30538635 AGCCTCCCCTTGGTCCCCTGAGG - Intronic
929593800 2:43163139-43163161 AGCCTCCAGACTGGCCCCTGGGG + Intergenic
933285478 2:80380412-80380434 AGCCTCCCGCAAGGGCTCTGAGG + Intronic
934534542 2:95121999-95122021 CGCCTCCCGTTAGGACCCGAGGG + Exonic
937263628 2:120602021-120602043 AGCCTCCCTGCAGGCTCCTGAGG + Intergenic
939175138 2:138739565-138739587 TGCCTCCCGTGATCCCCCTGTGG - Intronic
940226738 2:151408934-151408956 ATTCTTCTGTTAGGCCCCTGGGG - Intergenic
940312232 2:152291104-152291126 ACTCTACCTTTAGGCCCCTGAGG - Intergenic
944511457 2:200470105-200470127 GACCTCACGTTAGCCCCCTGGGG - Intronic
946366036 2:219249638-219249660 AGACTCCTGCTAGGGCCCTGGGG - Exonic
1170684735 20:18559224-18559246 AGCCTCCAGTGAGACCGCTGTGG + Intronic
1171249336 20:23636598-23636620 AGGCTCACGTGTGGCCCCTGCGG + Intronic
1171278655 20:23879066-23879088 AGGTTCCCGTGTGGCCCCTGTGG + Intronic
1173169916 20:40715676-40715698 ATCCTTCTTTTAGGCCCCTGGGG - Intergenic
1175204463 20:57301232-57301254 AGCCTCGCGTTCAGGCCCTGCGG + Intergenic
1175658150 20:60789924-60789946 AACCTCCAGTGAGGCCCGTGTGG + Intergenic
1180850713 22:19018691-19018713 AGTCTGCATTTAGGCCCCTGTGG - Intergenic
1184233285 22:43169702-43169724 TGCCTCCTGTTTGGACCCTGAGG - Intronic
950158077 3:10738913-10738935 AGCCTCCCCTTAGGCCCAAGTGG - Intergenic
950425197 3:12921310-12921332 TGCCTCCCGCCAGGGCCCTGGGG + Intronic
951717670 3:25665426-25665448 AGCGTCCACTTAGGCCCTTGGGG - Intergenic
952467886 3:33610397-33610419 AGCCATCAGATAGGCCCCTGAGG - Intronic
954896364 3:53978581-53978603 TCCCTCCCCTTAAGCCCCTGGGG - Intergenic
955664743 3:61338353-61338375 AGACTCCCTTCAGGCCCCTCAGG + Intergenic
961467143 3:127088917-127088939 GGCCTCCCGCCTGGCCCCTGGGG + Intergenic
962351495 3:134659796-134659818 ATCCTCCCGCCAGGCCCCTGGGG - Intronic
968863558 4:3192537-3192559 AGTCTCCCATTTGGCCCATGTGG - Intronic
985785878 5:1894279-1894301 ATCCTCCCCTTAGGCCTCTAAGG + Intergenic
986171030 5:5314829-5314851 AGCTTCCCCACAGGCCCCTGTGG + Intronic
988481887 5:31638594-31638616 ATCCCCCAGTTAAGCCCCTGGGG - Intergenic
992379932 5:76227044-76227066 TCCCTCCCGGAAGGCCCCTGAGG - Intronic
992732945 5:79690465-79690487 AGCCTACTGCTAGGCCCCCGGGG - Intronic
997031772 5:130138292-130138314 AGCCTGCCCTTAGACGCCTGAGG - Intronic
997194096 5:131966275-131966297 AGCCTCCCCCCAGGCCCCAGAGG + Intronic
1002633867 5:180597665-180597687 AGCCTCACGGGAGGGCCCTGGGG - Intergenic
1003925742 6:10876287-10876309 AGGCTCCCGCTAGGTCCCTGGGG + Intronic
1004343867 6:14830681-14830703 AGCCTCTTGTGTGGCCCCTGTGG - Intergenic
1006154228 6:32005662-32005684 AGACGCCCGTCAGGGCCCTGAGG - Intergenic
1006160532 6:32038396-32038418 AGACGCCCGTCAGGGCCCTGAGG - Exonic
1020915169 7:14184180-14184202 ACCCTCCCGTTGGATCCCTGTGG - Intronic
1023159055 7:37279721-37279743 ACCCTCCCGTTGGATCCCTGTGG - Intronic
1027221747 7:76218492-76218514 AGCCTCCCACAAGGCCACTGAGG + Intronic
1028223122 7:88219810-88219832 GGCCTCGCCCTAGGCCCCTGGGG - Intronic
1032094068 7:128928971-128928993 AGCCCTCAGTCAGGCCCCTGTGG - Intergenic
1032128503 7:129211432-129211454 GGCCTCCAGTTAGGCCCTTTGGG + Intronic
1033649287 7:143328703-143328725 ATCCTCCTTTTAGGCCCCAGAGG + Intronic
1035017941 7:155782623-155782645 AGCCACCCGGCAGGACCCTGGGG + Intergenic
1035097145 7:156364984-156365006 AGCCTCCCATCCGTCCCCTGGGG + Intergenic
1035242377 7:157540684-157540706 GGGCTCCCCTGAGGCCCCTGAGG + Exonic
1039332060 8:36548507-36548529 AGCATCCCGTTGTGCTCCTGGGG - Intergenic
1048571723 8:135662424-135662446 AGCCTCCAGAGAGGCCCGTGTGG - Intergenic
1049032393 8:140047464-140047486 AGCCTCTCCTCTGGCCCCTGGGG - Intronic
1049094170 8:140538632-140538654 ACCCTCCCGGCAGGTCCCTGTGG - Intronic
1051907809 9:22116693-22116715 AGCCTCCCTTTCATCCCCTGTGG - Intergenic
1189371544 X:40433251-40433273 TGCCTCCCTGTAGGCCTCTGTGG + Intergenic
1190161430 X:48034273-48034295 AGCCTCCGGGTTGGCCCCTTGGG - Intronic
1200145104 X:153922320-153922342 AGCCTGCCCTCAGGCCCCAGGGG + Intronic