ID: 1113437981

View in Genome Browser
Species Human (GRCh38)
Location 13:110307680-110307702
Sequence AGCCTCCCGTTAGGCCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437981_1113437991 3 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437991 13:110307706-110307728 CTTCTTTCCGGGTCGTGGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 98
1113437981_1113437985 -2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437981_1113437992 7 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437992 13:110307710-110307732 TTTCCGGGTCGTGGGGGGGACGG 0: 1
1: 0
2: 0
3: 9
4: 210
1113437981_1113437988 1 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437988 13:110307704-110307726 TCCTTCTTTCCGGGTCGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 87
1113437981_1113437990 2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437990 13:110307705-110307727 CCTTCTTTCCGGGTCGTGGGGGG 0: 1
1: 0
2: 1
3: 7
4: 90
1113437981_1113437987 0 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437987 13:110307703-110307725 CTCCTTCTTTCCGGGTCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
1113437981_1113437994 15 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437994 13:110307718-110307740 TCGTGGGGGGGACGGCCCTCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1113437981_1113437983 -9 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437981_1113437984 -8 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437981_1113437986 -1 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437986 13:110307702-110307724 TCTCCTTCTTTCCGGGTCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437981 Original CRISPR AGCCTCCCGTTAGGCCCCTG TGG (reversed) Intronic