ID: 1113437983

View in Genome Browser
Species Human (GRCh38)
Location 13:110307694-110307716
Sequence CGGGAGGCTCTCCTTCTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437976_1113437983 2 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437981_1113437983 -9 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437980_1113437983 -8 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437971_1113437983 15 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121
1113437972_1113437983 8 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437983 Original CRISPR CGGGAGGCTCTCCTTCTTTC CGG Intronic
900466895 1:2830139-2830161 CCCGAGGCTCTACTTCTTCCTGG + Intergenic
900734026 1:4283645-4283667 TGAAGGGCTCTCCTTCTTTCTGG + Intergenic
907014144 1:50994857-50994879 GGAGAGGCTCCCCTTCTTTAGGG - Intergenic
907933107 1:59018442-59018464 TGGGAGGCTTTACTGCTTTCTGG - Intergenic
910249076 1:85175270-85175292 CGGGAGGATCTCCTGAGTTCAGG + Intronic
910430781 1:87157638-87157660 TGGGAGGCTCTCATTGTGTCTGG + Intronic
910525132 1:88168999-88169021 CTCGAGGCTCTCCTTCTCTCAGG - Intergenic
913218179 1:116638006-116638028 CGGATCGCTCTCCTTCTTGCTGG + Intronic
915570411 1:156742427-156742449 TGGGAGGCTCCCCTTCTATTTGG - Intronic
918041018 1:180913564-180913586 TGGGAGGGTCTCATTCTTTAAGG + Intronic
918094048 1:181320065-181320087 CAGGAGGCTGTCCTTCTGCCAGG + Intergenic
919773192 1:201176122-201176144 TGGGTGCCTCTCCTCCTTTCTGG - Intergenic
920191476 1:204196676-204196698 CGGGACTTTCTCCTTCTTACCGG + Intergenic
1063695987 10:8335409-8335431 CTGGAGGCTCGCCTTCTGTTAGG + Intergenic
1067694257 10:48523864-48523886 GGGGAGGCTCCCCTTCACTCGGG - Intronic
1070858588 10:79629723-79629745 CTGGGGCCTCTCTTTCTTTCTGG + Intergenic
1074319646 10:112389803-112389825 CAGGAGTCTCACCTTCTCTCAGG + Intronic
1078095146 11:8292105-8292127 CTGGAGGCCCTCCCTCTCTCAGG + Intergenic
1083882504 11:65555472-65555494 AGGGAGGCTTTCCTCCTATCCGG + Intronic
1085784331 11:79437815-79437837 CGGGGCGCCCTCCTTCTTCCTGG + Intronic
1089287515 11:117417194-117417216 TGGGAGGCAATCCTTCCTTCAGG - Intergenic
1092046307 12:5433525-5433547 CAGGAGGCGCTGCTTCTTTGCGG + Intronic
1092821456 12:12357194-12357216 CGGCTAGCCCTCCTTCTTTCCGG - Exonic
1095800812 12:46268772-46268794 CGCCTGGCTCTCCTCCTTTCCGG + Intronic
1096091437 12:48904431-48904453 GAGGAGCCTCTCCTTCTTTTTGG - Exonic
1105623477 13:22090986-22091008 CCGTAGGCTCACCTTCTCTCTGG - Intergenic
1106949573 13:34868089-34868111 TGGGAGGCTATCTTTCCTTCTGG + Intergenic
1109906436 13:68847546-68847568 CGGGATTCTCTCCTACTGTCAGG - Intergenic
1110522085 13:76491571-76491593 AGGGAGTCTCTCCCTCTTCCAGG - Intergenic
1112933129 13:104766112-104766134 CTTGAAGCTCTCCTTTTTTCTGG + Intergenic
1113437983 13:110307694-110307716 CGGGAGGCTCTCCTTCTTTCCGG + Intronic
1113573077 13:111372598-111372620 CAGGAGGCTCTCTTTGTTCCTGG - Intergenic
1121561404 14:94878668-94878690 CAGGATGTTTTCCTTCTTTCAGG - Intergenic
1122934072 14:104947881-104947903 CGGGAGCCTCTCCTCCATGCAGG - Exonic
1124206988 15:27729524-27729546 TGGGAGGCTGTATTTCTTTCTGG + Intergenic
1124667409 15:31605265-31605287 CCTGAGGCTCTCCATCATTCTGG + Intronic
1128698658 15:69788129-69788151 CGGGGGGCTCTCCATTCTTCAGG + Intergenic
1129144532 15:73634509-73634531 TGCGAGGGTCTCCTTCTTCCAGG - Intergenic
1129245928 15:74278585-74278607 CTGGAGTCTCTCCTCATTTCAGG + Intronic
1132150703 15:99456087-99456109 TGGGAGGATCACCTTCTTGCAGG + Intergenic
1135575236 16:23580649-23580671 TGGGAGGCTCTCTTTCCTCCTGG - Intergenic
1139293940 16:65883614-65883636 CGGGAGGATCCCCTGGTTTCAGG - Intergenic
1141242823 16:82278874-82278896 CCGGAAGCTCCACTTCTTTCAGG - Intergenic
1141819303 16:86434068-86434090 TGGGAGGCTCTCCTCCTCCCAGG - Intergenic
1146576363 17:33995354-33995376 GGGGAGACTCTCCTTCTGCCAGG - Intronic
1146793185 17:35764419-35764441 CGGGAGGCTCCGCTTCCTGCCGG - Exonic
1149857549 17:60096074-60096096 CAGGAGGCCCTGCTTCATTCAGG - Intergenic
1151467412 17:74296245-74296267 CGGGAGGATCGCCTGCATTCAGG + Intronic
1152461435 17:80444383-80444405 AGAGATGCTCTCATTCTTTCCGG + Intergenic
1152647510 17:81476319-81476341 CCCGAGACACTCCTTCTTTCCGG - Intergenic
1153581259 18:6576002-6576024 TGGGAGGCCCTCCGTCTTGCTGG - Exonic
1156449163 18:37256993-37257015 CAGGAGTCTGTCCTTTTTTCAGG + Intronic
1157328593 18:46686684-46686706 CGGGAGACTGTCCTTATTTGTGG + Intronic
1159747797 18:72260500-72260522 CAGGAGACTCTGATTCTTTCAGG + Intergenic
1161627741 19:5337027-5337049 TGGGAGGGTCTCGTACTTTCTGG - Intronic
1163560716 19:18017801-18017823 CGGAAAGTTCTCCTTCTGTCAGG - Intergenic
1164946361 19:32296459-32296481 TGGCAGGCTCTCCTTTTTTAAGG + Intergenic
1165432072 19:35778541-35778563 CCGGAGGTTCTCCTGCCTTCCGG + Exonic
1167763205 19:51462231-51462253 CAGGAGCATCTCCTCCTTTCAGG + Intergenic
1167978718 19:53254814-53254836 CGGGTGAGTCTCCGTCTTTCGGG - Exonic
925101785 2:1253232-1253254 GGGGAGTCTCTCCTTCTGTGGGG - Intronic
926006860 2:9379175-9379197 CGGTAGGTTCTCCTTCTCTTTGG - Intronic
927982057 2:27380500-27380522 CGGGTGGCTTTGCTTCCTTCGGG + Exonic
928088376 2:28359557-28359579 CGGGGGCCTCTCCTTCCTTGTGG - Intergenic
929098734 2:38288484-38288506 CGGCAGGATCTCCTTTTTTAAGG - Intergenic
933949020 2:87312355-87312377 CAGGAGGGACTCCTTCTCTCTGG + Intergenic
936331177 2:111549241-111549263 CAGGAGGGACTCCTTCTCTCTGG - Intergenic
939866884 2:147482775-147482797 GGGGAGGCTCTCATCCCTTCAGG + Intergenic
942534915 2:176952614-176952636 CAGCAGGCTCGCCTTCTCTCAGG - Intergenic
946235844 2:218323831-218323853 TGGGAGGCATTCCTTCTCTCCGG - Intronic
947808877 2:232987554-232987576 TGGGAGCCTCTCCTTCCTGCAGG - Intronic
948350444 2:237335903-237335925 TGGGAAGCTCTCATTCTCTCTGG - Intronic
948391696 2:237616082-237616104 CCAGAGGCCCTCCTTCTTTTTGG + Intergenic
948483894 2:238267899-238267921 GGGCAGGGTCTCCATCTTTCTGG - Intronic
1171308328 20:24125028-24125050 GGGGAAGCTCTGCTGCTTTCAGG - Intergenic
1175212776 20:57371844-57371866 TGGCAGGATTTCCTTCTTTCAGG - Intronic
1175243182 20:57564613-57564635 GGTGAGGCTCTCCTTCATTTAGG + Exonic
1178351207 21:31873925-31873947 CGGGAGACTCACCTTCTCCCCGG - Exonic
1180819487 22:18816086-18816108 CGGATCGCTCTCCTTCTTGCTGG + Intergenic
1181205712 22:21250531-21250553 CGGATCGCTCTCCTTCTTGCTGG + Intergenic
1185004230 22:48265982-48266004 CGGGAGGCTCACCTGAGTTCAGG - Intergenic
1203221211 22_KI270731v1_random:44882-44904 CGGATCGCTCTCCTTCTTGCTGG - Intergenic
1203269614 22_KI270734v1_random:41939-41961 CGGATCGCTCTCCTTCTTGCTGG + Intergenic
953985028 3:47435022-47435044 CAGTAGGCTCTCCTTGTTTGCGG + Exonic
959122115 3:102245052-102245074 TGTGAGGCTCTCCTTGTTTCTGG + Intronic
964441988 3:156721223-156721245 CAGGAACCTCTCATTCTTTCTGG + Intergenic
964761347 3:160137470-160137492 CAGAAGGCTCTCTTTATTTCTGG + Intergenic
967316376 3:188154646-188154668 CGGGCGACCCTCCTTCTCTCTGG - Intronic
968002261 3:195214228-195214250 GAGGGGGCTTTCCTTCTTTCTGG - Intronic
969587924 4:8105138-8105160 CGGGAGGATTCCCTTCTGTCTGG + Intronic
977718578 4:100211779-100211801 CGGGAAGCACTGATTCTTTCAGG - Intergenic
983639732 4:169933920-169933942 AGGGAGGCTGTCCTCCTTTGGGG + Intergenic
985319198 4:188690084-188690106 CGGCAGGCTCTCCTTTTGACAGG + Intergenic
987624225 5:20376787-20376809 CGGGAGGATCTCCTGAGTTCAGG + Intronic
990755186 5:59060967-59060989 TGGGAGGCTCTCCTTCCTACAGG + Intronic
994411273 5:99410072-99410094 CGGGAGTTGCTCCTTCCTTCTGG + Intergenic
994482556 5:100355175-100355197 CGGGAGTTGCTCCTTCCTTCTGG - Intergenic
996262641 5:121492446-121492468 CAGGAGGCGCTCCTTATTTATGG + Intergenic
997198895 5:131997826-131997848 CCAGAGGGTCTCGTTCTTTCAGG + Intronic
1001769753 5:174284801-174284823 AGGGAGGATCTCTTTCCTTCTGG - Intergenic
1002882348 6:1264029-1264051 GAGGAGGCTCTCCTCCTCTCAGG - Intergenic
1003604219 6:7544137-7544159 CGGGAGGCGGTCATTCTTTCCGG + Intronic
1009620237 6:66065555-66065577 CAGAAGCCTCTCCTTCTTTCAGG + Intergenic
1013604425 6:111734580-111734602 AGGGAGGCTCCACTTCTCTCTGG + Intronic
1019107924 6:169684238-169684260 CAGGAGCCTCTCCTGCTTTGAGG - Intronic
1019288585 7:236053-236075 TGGCAGCCTCTCCTTCTTCCTGG - Intronic
1019622931 7:2001443-2001465 AGGCAGGCTCTCCTGGTTTCTGG - Intronic
1020164078 7:5794647-5794669 CTGGAGGCGTTCATTCTTTCTGG - Intergenic
1021898032 7:25255996-25256018 CTGGAAGCTCTCCTTCTATAGGG - Intergenic
1027916248 7:84326075-84326097 CAAGATGCTCTTCTTCTTTCTGG + Intronic
1033674150 7:143521112-143521134 CCTGAGGCTTTCCTCCTTTCAGG - Intergenic
1040918282 8:52586684-52586706 CTGGAGACTCTCCTTCTGACAGG - Intergenic
1044682789 8:94799158-94799180 CCCGAGGCTCTCATTCTGTCTGG + Intergenic
1044941503 8:97348646-97348668 CTGGAGCCTCTGTTTCTTTCTGG - Intergenic
1045653804 8:104366984-104367006 TGGGAGGCTCTCCCTATCTCAGG + Intronic
1046852704 8:118993580-118993602 CGGGTGGCTCACCTTATGTCAGG - Intergenic
1049498554 8:142948388-142948410 GGGGAGGCTGTGCTTCTATCTGG + Intergenic
1057998253 9:99840208-99840230 CGGCTGGCTTTCCTTCTTGCTGG + Intronic
1059407200 9:114108574-114108596 CCGGTGGTTCTCCCTCTTTCAGG + Intergenic
1061002636 9:127910942-127910964 CGGGAGGCACTCCTTCTGATGGG + Intronic
1062106616 9:134758352-134758374 CGGGAGGCCCTTCTCCTTCCAGG + Intronic
1186631360 X:11352424-11352446 AGGGAGGCCCTACTTCTTACTGG - Intronic
1189383517 X:40518668-40518690 TGGGAGGGACTCCTTCTGTCTGG + Intergenic
1192498454 X:71632455-71632477 ATGGGGGCTCTCCTTCTTCCGGG + Intergenic
1197615689 X:128688261-128688283 CGGTAGTCTCTCTTTTTTTCTGG - Intergenic
1200039709 X:153356122-153356144 CTGGAGGGTCTCCTGCTGTCAGG - Intronic
1200744645 Y:6893219-6893241 CAGGAGTGTATCCTTCTTTCTGG - Intergenic