ID: 1113437984

View in Genome Browser
Species Human (GRCh38)
Location 13:110307695-110307717
Sequence GGGAGGCTCTCCTTCTTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437971_1113437984 16 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437981_1113437984 -8 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437980_1113437984 -7 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437976_1113437984 3 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203
1113437972_1113437984 9 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437984 Original CRISPR GGGAGGCTCTCCTTCTTTCC GGG Intronic
901380975 1:8873990-8874012 TGGAGGCTCTCATTTTTACCTGG - Intronic
901923029 1:12549397-12549419 GGGAGGCTGGCCTCCTTCCCTGG + Intergenic
902363227 1:15953681-15953703 GGGAGGCTCTGCTGCTTCCATGG - Intronic
902749895 1:18500456-18500478 GGGAGGATGTCCTTATTTGCAGG - Intergenic
903237683 1:21960907-21960929 AAGATGCTCTCCTTGTTTCCTGG - Intergenic
904322000 1:29703871-29703893 TGGGTGCTCTCCTTCCTTCCGGG - Intergenic
906935117 1:50208049-50208071 GGCAAACTCTCCTTCCTTCCTGG - Intergenic
907311428 1:53541172-53541194 GGGAGGCTCACCATTTCTCCCGG - Intronic
908421879 1:63966796-63966818 GTGAGGCTCATCTTCTTTACTGG + Intronic
909808381 1:79900317-79900339 GGGATCCTCTCCTCATTTCCAGG + Intergenic
910430782 1:87157639-87157661 GGGAGGCTCTCATTGTGTCTGGG + Intronic
913414425 1:118589562-118589584 GGCAGGTTATCCTTCCTTCCAGG + Intergenic
915570410 1:156742426-156742448 GGGAGGCTCCCCTTCTATTTGGG - Intronic
916114077 1:161472728-161472750 GGGAGGCTCTCCTCACATCCAGG - Intergenic
918861176 1:189828125-189828147 GGGAGGCTGTATTTTTTTCCAGG - Intergenic
919773191 1:201176121-201176143 GGGTGCCTCTCCTCCTTTCTGGG - Intergenic
919860442 1:201736446-201736468 GGGAGGCTCTCCTTGTCTCCTGG - Intronic
920215356 1:204358768-204358790 GGATGGCTCTCCCTCTATCCCGG + Intronic
924510206 1:244723818-244723840 GGGAGGTTGACCTTCTCTCCAGG + Intergenic
1063247779 10:4240640-4240662 GGGTGGCTCTACTTGTTTCCTGG + Intergenic
1065978379 10:30864319-30864341 TGGAGGCTACCCTTCCTTCCAGG + Intronic
1067048994 10:43001268-43001290 GGGAGGCTCTGCTGGTCTCCGGG + Intergenic
1067694256 10:48523863-48523885 GGGAGGCTCCCCTTCACTCGGGG - Intronic
1070523760 10:77277150-77277172 GGGAAGCTCTCCCTCCTTCAAGG + Intronic
1070890996 10:79942181-79942203 GGGAGACTCTCCTTGCTTTCTGG + Intronic
1071390121 10:85165707-85165729 GGGAGGCTCTGTCTCTTTACAGG - Intergenic
1072625465 10:97108236-97108258 GGTAGGCTCTCCTTGCTGCCTGG + Intronic
1074199307 10:111220234-111220256 GGAATGTTCTCCTTCTTGCCTGG - Intergenic
1075588142 10:123672083-123672105 CTGGGGCTCTCCTGCTTTCCAGG - Intronic
1075609090 10:123836909-123836931 AGGAGACCCTCCTCCTTTCCAGG + Intronic
1076096071 10:127736181-127736203 GGGAGGCGGGCCCTCTTTCCAGG + Intergenic
1076523384 10:131094950-131094972 GGGAGGCTCCCTTTCTTTTCAGG - Intronic
1076607438 10:131698282-131698304 GGCAGGTTCCCCTTCTCTCCAGG + Intergenic
1076720303 10:132389485-132389507 GGGAGGGCCTCATTCCTTCCCGG - Intergenic
1077056918 11:598253-598275 GGGAGGCTGTCCTGCTTCTCTGG + Intronic
1078526123 11:12102878-12102900 GGGATGTTCTCCTCCTTTTCAGG - Intronic
1079515321 11:21260724-21260746 AGGAGCCTCTCCTTTTTTCTTGG + Intronic
1080637810 11:34139065-34139087 GCAGGCCTCTCCTTCTTTCCAGG - Intronic
1081014415 11:37858008-37858030 AGGAGGCTCTCCTTCTGTGCTGG + Intergenic
1082116521 11:48335648-48335670 GGGAAGCCTCCCTTCTTTCCAGG + Intergenic
1083008576 11:59372277-59372299 GGGAGTGTCCCCTTTTTTCCAGG - Intergenic
1083150441 11:60788695-60788717 CAGAGGGTCTCCCTCTTTCCTGG - Intronic
1083724725 11:64622221-64622243 AGGAGCCTCTCCTTGTTTGCTGG - Intronic
1083961163 11:66015765-66015787 GGGAGGTGCTTCTTCTGTCCTGG + Intergenic
1084259511 11:67966360-67966382 GGGAGGCTCTCATCCATTACAGG - Intergenic
1084556021 11:69876283-69876305 GCGAGGCTGTCATTCTTGCCTGG - Intergenic
1084911839 11:72395839-72395861 GGGAGGCTCTGCTTCCTTCCTGG - Intronic
1086500794 11:87451341-87451363 GGGAGGTGCTGTTTCTTTCCCGG + Intergenic
1086923009 11:92608842-92608864 GGGAGGTTCTCAATGTTTCCTGG - Intronic
1087011356 11:93516984-93517006 GGGAGCCTCTCCTTAGATCCAGG + Intronic
1087768795 11:102184477-102184499 GGAAGGCTCCCCTTCAGTCCTGG - Intronic
1089140569 11:116280689-116280711 GGGAGGCTGGGCATCTTTCCAGG - Intergenic
1089287514 11:117417193-117417215 GGGAGGCAATCCTTCCTTCAGGG - Intergenic
1089775089 11:120830448-120830470 GGGAGGCTCTCCCTCCTTTTTGG + Intronic
1091158594 11:133398106-133398128 GGGAGGCTCACCTGCTGACCTGG + Intronic
1091791773 12:3276066-3276088 GCGAGCCTCTCTTTCTTCCCAGG - Intronic
1092046308 12:5433526-5433548 AGGAGGCGCTGCTTCTTTGCGGG + Intronic
1092821455 12:12357193-12357215 GGCTAGCCCTCCTTCTTTCCGGG - Exonic
1093910834 12:24745053-24745075 GAAAGGCTCTCTTTCCTTCCAGG - Intergenic
1095800813 12:46268773-46268795 GCCTGGCTCTCCTCCTTTCCGGG + Intronic
1096098722 12:48956350-48956372 AGGCGGGTCTCCATCTTTCCAGG - Intronic
1096525514 12:52207854-52207876 GGGAGGCTCTCTTCCTCGCCAGG - Intergenic
1101109717 12:101473737-101473759 GGGAGGCACTCCATTTTTCTTGG + Intergenic
1101443202 12:104718957-104718979 GGAAGGTTCTCCGACTTTCCAGG + Intronic
1102568412 12:113812307-113812329 GGGCTGCTCCCCTCCTTTCCTGG + Intergenic
1103555506 12:121763931-121763953 GGGGGGCTCTCCTTACCTCCAGG - Intronic
1103722041 12:122980428-122980450 GCGAGGGTCGCCTTCTTCCCAGG + Exonic
1104572528 12:129937439-129937461 GGGGGTCTCTCTTTCATTCCAGG - Intergenic
1105210327 13:18253535-18253557 GGCAGGCTCCCCACCTTTCCTGG + Intergenic
1106949574 13:34868090-34868112 GGGAGGCTATCTTTCCTTCTGGG + Intergenic
1107592227 13:41920270-41920292 TTGAGGCTCCCCTTCTTCCCTGG + Intronic
1108717091 13:53091778-53091800 GGGATGCTCTGGTTCTTTCCTGG - Intergenic
1109843238 13:67948952-67948974 GTGAGGCTCTCATTCTTAACTGG - Intergenic
1110037333 13:70704695-70704717 GGGAGGATCTCCTTTTTTAGAGG + Intergenic
1110127858 13:71969720-71969742 TGTAAGCTCTCCTTCTTACCGGG + Intergenic
1110522084 13:76491570-76491592 GGGAGTCTCTCCCTCTTCCAGGG - Intergenic
1110867794 13:80417045-80417067 GGGAGGCCCTCATACTTTCATGG - Intergenic
1111545676 13:89732640-89732662 GGGAGTCTCTCTTTATTGCCAGG + Intergenic
1113437984 13:110307695-110307717 GGGAGGCTCTCCTTCTTTCCGGG + Intronic
1113683635 13:112262403-112262425 GGGTAGCTCTCCTTGTCTCCTGG + Intergenic
1118150446 14:63183323-63183345 AGGAGGCTATCATTTTTTCCAGG + Intergenic
1121835837 14:97091468-97091490 AGGTGGCTCTGCTTTTTTCCAGG - Intergenic
1122502576 14:102211046-102211068 GGGAGGCTCTGCTGCTCCCCCGG + Intronic
1123786297 15:23678066-23678088 AGGAGGCTCTCTTTGTGTCCCGG - Intergenic
1128047884 15:64635090-64635112 GGGAGACTCTCTTTCTCCCCTGG - Intronic
1132632611 16:927098-927120 GGCAGCCTCTCCTTCTCTCATGG + Intronic
1132739096 16:1402141-1402163 GTGAGGCACTGCTGCTTTCCAGG - Intronic
1132739114 16:1402265-1402287 GTGAGGCACTGCTGCTTTCCAGG - Intronic
1134072622 16:11270082-11270104 GGGTGTCTTTCCTTCTTTCCTGG + Intronic
1134316696 16:13125442-13125464 TTGAGTCTCTACTTCTTTCCTGG + Intronic
1138395036 16:56697579-56697601 GGGTGGCTCTGCTTCCTCCCTGG - Intronic
1138908003 16:61361417-61361439 GGGAATCTCTGCTGCTTTCCAGG + Intergenic
1140066015 16:71611691-71611713 GGGAGGCGCTACTTCTTCTCCGG + Intergenic
1141224809 16:82104877-82104899 AGGTGGCTCTCCTTATTTTCAGG + Intergenic
1141617734 16:85219876-85219898 GGCAGGCTCTCCTGGTCTCCTGG + Intergenic
1141765855 16:86059754-86059776 GGGAGGCTCTTCTGCTTGGCAGG + Intergenic
1142713439 17:1735764-1735786 GGGAGTCTCTCCTCCTTGCCAGG - Intronic
1143022470 17:3923966-3923988 GAGATTCTCTGCTTCTTTCCTGG - Intronic
1144649919 17:17000932-17000954 GGAAGTCTCTCTGTCTTTCCAGG + Intergenic
1145787762 17:27605133-27605155 GGGATGCTCTTGCTCTTTCCTGG + Intronic
1146328393 17:31906381-31906403 GGGAGTCTCGCCTTGTTGCCTGG - Intergenic
1148462892 17:47848263-47848285 GGGAGGCTCTGCAGCTCTCCAGG + Exonic
1149336879 17:55644461-55644483 GGGAGGCTCTGTTTATTCCCGGG + Intergenic
1149705253 17:58689245-58689267 GGGAGTCTCTCTCTGTTTCCAGG + Intronic
1151460671 17:74252385-74252407 GGGAGGCTCCCCTCCTTACTAGG - Intronic
1152555756 17:81052426-81052448 GGCAGGTGCTCCTTCCTTCCAGG - Intronic
1152647508 17:81476318-81476340 CCGAGACACTCCTTCTTTCCGGG - Intergenic
1152694297 17:81735919-81735941 GGGAGACTCTCCTAACTTCCAGG + Intergenic
1152719347 17:81915253-81915275 GGGGAGCTCCCCTTCTGTCCTGG + Intronic
1152788733 17:82266351-82266373 GGGAGGCCCTTCTCCCTTCCTGG + Intronic
1155943350 18:31821798-31821820 AGGAAGCTCCCCTTCTTTGCCGG - Intergenic
1157163370 18:45335810-45335832 GGGAGAGGCTCCTCCTTTCCTGG - Intronic
1157271469 18:46279622-46279644 GGAAGTTTGTCCTTCTTTCCTGG + Intergenic
1158211349 18:55053959-55053981 GGGAGCCTCTCGTGCTTCCCAGG - Intergenic
1158618027 18:59005706-59005728 GTGTGCCTCACCTTCTTTCCTGG + Intergenic
1159845643 18:73456498-73456520 ATGAGGCTCTTCTTCTTTCACGG - Intergenic
1160187048 18:76684140-76684162 GGGAGCCTCCCCTGCTCTCCAGG - Intergenic
1161084047 19:2325770-2325792 GGGTGGCTCTCCTGCTCTGCTGG + Intronic
1162018815 19:7859507-7859529 GTGAAGCTCTCCTTCTCCCCAGG - Intronic
1162729936 19:12712322-12712344 GGGAGACTCCCCCACTTTCCTGG - Intronic
1165383832 19:35498873-35498895 GGGAGTCTCACCTTCTTCCTCGG - Exonic
1165389675 19:35531243-35531265 GTGAGGCTCTCCTGCTTTGATGG - Intergenic
1166239442 19:41480037-41480059 GGGAGGATCTCCTGATTTCTTGG - Intergenic
1166271232 19:41715431-41715453 GGGAGGGGCTGCTTCTGTCCTGG + Intronic
1166646921 19:44539038-44539060 GGGATGCTGCCATTCTTTCCTGG + Intergenic
1167819283 19:51911242-51911264 GGGAGTCTCACCTTGTTGCCTGG + Intronic
925316053 2:2924422-2924444 CGGAGACTCTCCTTCTTTGCTGG - Intergenic
927924252 2:26999009-26999031 GGAATGCTCTCCTCCTTTCAAGG - Intronic
928285592 2:29987555-29987577 TTGAGGCTCTCCTGCATTCCAGG + Intergenic
933762121 2:85679546-85679568 GGAAGGCGCTCCTTCATTACAGG + Intergenic
935935944 2:108183059-108183081 TGGAGGCTTTCCTCCATTCCAGG + Intergenic
937287027 2:120760250-120760272 CGGAGGCTCTCCCTTTTTCCTGG + Intronic
938143823 2:128817796-128817818 GGGAAGCTCTGCTTCTCTCCTGG + Intergenic
939866885 2:147482776-147482798 GGGAGGCTCTCATCCCTTCAGGG + Intergenic
940321721 2:152384553-152384575 GGAAGGCTTTGCTTCTGTCCTGG - Intronic
946219769 2:218216762-218216784 GGGTGCCTCTTTTTCTTTCCAGG - Intergenic
946412350 2:219521663-219521685 GGGTGGCTGTCCATCTCTCCTGG - Intronic
947808876 2:232987553-232987575 GGGAGCCTCTCCTTCCTGCAGGG - Intronic
948476854 2:238226135-238226157 GGGAGGCTCGGCTTCTCTGCTGG - Intronic
1170462270 20:16588369-16588391 GGTAGACTCTCTCTCTTTCCTGG - Intergenic
1170715200 20:18825074-18825096 TGGTGGCTTTCCTTCTTCCCTGG - Intronic
1174139022 20:48400066-48400088 GGGGGGCGCTCTTTCTTTCCTGG - Intergenic
1176295435 21:5069650-5069672 GGGAGGCGACCCTTCTTCCCTGG - Intergenic
1178900119 21:36591839-36591861 GTGAAGCTCTCCTCCATTCCTGG + Intergenic
1179861615 21:44192474-44192496 GGGAGGCGACCCTTCTTCCCTGG + Intergenic
1179899232 21:44380368-44380390 GGGCGGCTTTCCTTCCTTCCCGG + Intronic
1181400484 22:22647710-22647732 GGCAGGCTCCCCGCCTTTCCTGG - Exonic
1181616580 22:24059060-24059082 AGGAGGCTCTGCCTCTCTCCAGG - Intronic
1181702463 22:24628808-24628830 GGCAGGCTCCCCGCCTTTCCTGG - Exonic
1181998003 22:26898118-26898140 GGGAGGCATTCCTGCTATCCAGG + Intergenic
1182104977 22:27682723-27682745 GGCAGGCTGACCTTCGTTCCTGG - Intergenic
1183666753 22:39250494-39250516 GCCAGGCTCTCTTTCTTTGCTGG - Intergenic
950652419 3:14415595-14415617 GGAAGGCTCTCCTGGATTCCTGG - Intronic
953086386 3:39672060-39672082 GGGAGGTTTCCCTTCCTTCCAGG + Intergenic
955396841 3:58563604-58563626 TGGAGTCTCTCCTGCATTCCAGG - Intergenic
966280634 3:178222607-178222629 TGGAGGCTCTCAATCTGTCCCGG - Intergenic
970027820 4:11642180-11642202 GGTAGGCTTTTCTTCTTCCCTGG - Intergenic
972294055 4:37719640-37719662 GGGAAGCTGGGCTTCTTTCCTGG - Intergenic
973551389 4:52038631-52038653 GTGAGGCTCTCTTTGTTTCTCGG + Intergenic
973978096 4:56283209-56283231 AGGAGGCTGCCCTTCTTTCTTGG - Intronic
976164689 4:82241835-82241857 TGGAGACCCTCCTTCTTTGCTGG - Intergenic
977630052 4:99232425-99232447 GGGACTCTCTCTTTCTTCCCAGG - Intergenic
979970835 4:127132818-127132840 TGTAGGCTCTCCTTCCTTCATGG - Intergenic
981779621 4:148412238-148412260 GGGTGGCTTTCATTCTTTGCAGG + Intronic
985170186 4:187140286-187140308 AGCAGGCTTTCCTTCTTTCCTGG - Intergenic
985329920 4:188820702-188820724 TGGAGTCTTTCATTCTTTCCAGG + Intergenic
985548316 5:520881-520903 GCCAGGCTTTCCTTCCTTCCTGG - Intronic
994107872 5:95966459-95966481 GGCAGCCTCTGCTTCTTCCCAGG + Intergenic
995418318 5:111934800-111934822 AGGAGGTTCTCCATATTTCCAGG - Intronic
995679271 5:114698954-114698976 GGAAGGCTCTTCTGCTTTCCAGG - Intergenic
998918236 5:147039453-147039475 GGGGGGCTCTACTTCTGTGCAGG + Intronic
1001769752 5:174284800-174284822 GGGAGGATCTCTTTCCTTCTGGG - Intergenic
1003604220 6:7544138-7544160 GGGAGGCGGTCATTCTTTCCGGG + Intronic
1004459583 6:15823191-15823213 GGGAGGCTGTCCTTATTATCAGG - Intergenic
1009620238 6:66065556-66065578 AGAAGCCTCTCCTTCTTTCAGGG + Intergenic
1009636653 6:66274551-66274573 TTGAGGCTCTTCTTGTTTCCAGG + Intergenic
1013352292 6:109316713-109316735 GGGAAGTGTTCCTTCTTTCCCGG + Intergenic
1013409862 6:109874361-109874383 GGGAGCCTCACCTGATTTCCAGG + Intergenic
1014619605 6:123649475-123649497 GGCAGGCTCTCCTTCTTTTTAGG - Intergenic
1017320427 6:153085918-153085940 GGCAGGCTGTCCTTCTAACCTGG + Intronic
1017830685 6:158126304-158126326 GGGAGGCATTTCTTATTTCCTGG - Intronic
1017994764 6:159522205-159522227 GGGAGGCTCTGGTTTCTTCCAGG - Intergenic
1019288584 7:236052-236074 GGCAGCCTCTCCTTCTTCCTGGG - Intronic
1019593419 7:1847159-1847181 GGGAGGAACTCCTTGTTCCCAGG - Intronic
1020586750 7:10078960-10078982 GGGACCCACTCCTTCTGTCCAGG - Intergenic
1021166338 7:17347182-17347204 GAGAGGCTCTCCTTCTCTGTAGG + Intergenic
1024090998 7:45939696-45939718 GGGCCTCTCCCCTTCTTTCCTGG - Intergenic
1026330895 7:69351677-69351699 GAGTGCCTGTCCTTCTTTCCTGG - Intergenic
1034482216 7:151330967-151330989 AGGAGCCTCTCTTTCTCTCCAGG + Intergenic
1035203197 7:157279532-157279554 GCGTGGCTCTCCTTCCTTCCTGG - Intergenic
1035582695 8:749854-749876 GGGAGGGTCCCCTCCTCTCCTGG + Intergenic
1036655168 8:10673033-10673055 GGGAGGCTCTGCTGCTTTCTAGG + Intronic
1039430147 8:37519529-37519551 GGGTGGCACTCCTTCCTTCCTGG - Intergenic
1040595788 8:48836091-48836113 AGAAGGCTGTCCTTCTTGCCTGG - Intergenic
1040744190 8:50620067-50620089 GGCAGGCTGTGCTCCTTTCCAGG + Intronic
1046621003 8:116529661-116529683 GGGAATCTATCCTTCTTTCAAGG - Intergenic
1048366327 8:133742031-133742053 GGGAGGGTCTTCTTTTCTCCAGG + Intergenic
1048752772 8:137698416-137698438 GGGAGGCTCAACCTCTGTCCAGG + Intergenic
1050648814 9:7752980-7753002 AGGAGGATCTGCTTCTGTCCAGG - Intergenic
1051248591 9:15136606-15136628 GGGAAAATCTCCTTCTTGCCTGG + Intergenic
1052755025 9:32532169-32532191 GTGACACTCCCCTTCTTTCCTGG - Intergenic
1055736521 9:79336543-79336565 CTGAGCCTCTCCATCTTTCCTGG - Intergenic
1056417104 9:86387541-86387563 GGGAAGCTCTCTTGCTTTTCTGG + Intergenic
1057722912 9:97547144-97547166 GGGAGGCCCTCTCTGTTTCCTGG - Intronic
1059340441 9:113594765-113594787 AGGAGGCCCACCCTCTTTCCCGG - Intronic
1060901135 9:127259181-127259203 AGGAGGTTGTCCTGCTTTCCAGG + Intronic
1061444136 9:130628237-130628259 GGGAGGCTCTGTGTCTGTCCAGG - Intronic
1062146456 9:134992298-134992320 GGGGGGCGCTCCCTCCTTCCTGG - Intergenic
1062546559 9:137066218-137066240 GTGGGGCTCTCCATCTTGCCTGG - Intronic
1062675702 9:137742377-137742399 GGGAGGGTTTGCTTCATTCCAGG - Intronic
1185579304 X:1198184-1198206 GGGAGGGTGTCCTGCCTTCCTGG - Intronic
1185579325 X:1198244-1198266 GGGAGGGTGTCCTGCCTTCCTGG - Intronic
1185579337 X:1198276-1198298 GGGAGGGTGTCCTGCCTTCCTGG - Intronic
1185579349 X:1198308-1198330 GGGAGGGTGTCCTGCCTTCCTGG - Intronic
1185579358 X:1198336-1198358 GGGAGGCTGTCCTGCCTTCGAGG - Intronic
1185579390 X:1198428-1198450 GGGAGGGTGTCCTGCCTTCCTGG - Intronic
1186618847 X:11215928-11215950 GGGAGGTTCTCCCTCATACCAGG + Intronic
1188945265 X:36293188-36293210 GGGAAGTTCTCCTTTTATCCTGG + Intronic
1190384178 X:49868468-49868490 GGGACCCCCTCCTTATTTCCAGG + Intergenic
1192168776 X:68841757-68841779 GGCAGCCTCTTCCTCTTTCCAGG - Exonic
1195625736 X:107004377-107004399 GTCAGGGTCTCATTCTTTCCCGG - Intergenic
1195820143 X:108936059-108936081 TGGAAGATTTCCTTCTTTCCTGG + Intergenic
1199544203 X:148990274-148990296 GGGATGCTCTCCTGCCTTCTTGG - Intronic
1199924698 X:152450469-152450491 GGGAGGTTTGCCTTGTTTCCCGG - Intronic