ID: 1113437985

View in Genome Browser
Species Human (GRCh38)
Location 13:110307701-110307723
Sequence CTCTCCTTCTTTCCGGGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113437981_1113437985 -2 Left 1113437981 13:110307680-110307702 CCACAGGGGCCTAACGGGAGGCT 0: 1
1: 1
2: 0
3: 10
4: 104
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437980_1113437985 -1 Left 1113437980 13:110307679-110307701 CCCACAGGGGCCTAACGGGAGGC 0: 1
1: 0
2: 1
3: 3
4: 54
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437971_1113437985 22 Left 1113437971 13:110307656-110307678 CCGAGCTCCTCGGCCAAGGAGCA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437976_1113437985 9 Left 1113437976 13:110307669-110307691 CCAAGGAGCACCCACAGGGGCCT 0: 1
1: 0
2: 2
3: 19
4: 286
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1113437972_1113437985 15 Left 1113437972 13:110307663-110307685 CCTCGGCCAAGGAGCACCCACAG 0: 1
1: 0
2: 3
3: 15
4: 204
Right 1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG 0: 1
1: 0
2: 1
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113437985 Original CRISPR CTCTCCTTCTTTCCGGGTCG TGG Intronic
900868462 1:5285350-5285372 CTCACCTTCTCTCCTGCTCGAGG - Intergenic
902561785 1:17282101-17282123 CTCCCCTTCCTTCCTGTTCGAGG + Intronic
904772086 1:32886304-32886326 GTCCCCTTCTCTCCGGGGCGGGG + Intronic
914835248 1:151201191-151201213 CCCTTCTTCTTTCTGGGTTGGGG - Intronic
919639870 1:200037065-200037087 CTCTCCATCTTTCGGGGATGTGG + Intronic
919809714 1:201400777-201400799 CTCTGCTTCCTTCCAGGTTGTGG + Intergenic
922539336 1:226407521-226407543 CTCTTCTCCTTTCTGGGTGGCGG - Intronic
924358680 1:243212698-243212720 CTCTCTTTCTTTCAGGGTCGCGG + Intronic
1063281416 10:4633404-4633426 CGCTCCTTCCTTCCGGGTGTGGG + Intergenic
1063689191 10:8268133-8268155 CTCTCCTGCTCCCCGTGTCGGGG + Intergenic
1074183820 10:111084698-111084720 CTCTCCTTCTGTCCAGGCCATGG + Intergenic
1075274520 10:121081119-121081141 GTCTCCTTCTGCCCAGGTCGGGG + Intergenic
1076076211 10:127535816-127535838 CCCTCCTTCTTTCAGGGAAGGGG + Intergenic
1080637806 11:34139059-34139081 CTCTCCTTCTTTCCAGGCTGGGG - Intronic
1081187903 11:40067291-40067313 CTCTGCTTCTTTCCTGATCTTGG + Intergenic
1081864650 11:46352807-46352829 CTCTCCTCTGTTCCGTGTCGGGG + Intronic
1082805864 11:57449866-57449888 CTCTCATTCATTACAGGTCGGGG - Intergenic
1087533609 11:99415417-99415439 CTCTCCTTCCTTCTGGGTATGGG + Intronic
1089413354 11:118265849-118265871 CTCTTTTTCTTTCAGGGTCCTGG - Intergenic
1091692048 12:2604018-2604040 CTTTCCCTCCTTCTGGGTCGGGG + Intronic
1100376938 12:94025996-94026018 CTCTTCTTCTTTTAGGGTCTTGG - Intergenic
1101670427 12:106866521-106866543 GTCCCCTTCTTTCCTGGTCTTGG + Intronic
1104572526 12:129937433-129937455 CTCTCTTTCATTCCAGGTCTGGG - Intergenic
1104734061 12:131125371-131125393 CTCTCCTTCTTTCCTCGGTGGGG - Intronic
1109360659 13:61291580-61291602 CTCAGCTTCTTTCCGGTTTGAGG - Intergenic
1113437985 13:110307701-110307723 CTCTCCTTCTTTCCGGGTCGTGG + Intronic
1113950446 13:114068584-114068606 ATCTCCTTGTTTTAGGGTCGTGG + Intronic
1114512782 14:23276342-23276364 CTCTTCTTCTTTCCAGGTACTGG - Exonic
1117977875 14:61316602-61316624 CTCCCCTGCTTTCAGGGTCAGGG + Intronic
1118475372 14:66111429-66111451 CTCTGCTTCTTTCAGTGTGGTGG + Intergenic
1119417738 14:74485480-74485502 CTTTCCTTCTGTCTGGGTTGGGG + Intronic
1122784542 14:104157739-104157761 CTCTCCTTCCCTCCAGGCCGAGG + Exonic
1123710053 15:22980391-22980413 CTCCCCTTCCTCCCGGGGCGGGG + Intronic
1124241083 15:28028053-28028075 CTCTCTTGCTTTCCAGGTCACGG - Exonic
1126109846 15:45168719-45168741 CTCTCTTGCTTTCTGGGTCTTGG + Intronic
1126597641 15:50398047-50398069 CTTTCCTTCTTACTGGGTCCAGG + Intergenic
1135858172 16:26031265-26031287 CTCTGGTTCTTCCCGGGGCGGGG - Intronic
1137946042 16:52734189-52734211 CTCTCCTCCTTTCCTGGCTGTGG + Intergenic
1142714068 17:1738401-1738423 CACCCCTTCTCTCAGGGTCGTGG - Exonic
1144404959 17:14943184-14943206 CTCTGCTTCTTTACTGGTGGTGG + Intergenic
1145028646 17:19488132-19488154 CTCTTCTTCTCTCTTGGTCGTGG - Intergenic
1146362089 17:32185412-32185434 CTCTCCTTTTTTTTGGGTCAGGG + Intronic
1152802661 17:82338976-82338998 CTCTCCTGCTTGTGGGGTCGAGG - Intergenic
1152885139 17:82845177-82845199 CTTTCCTAGTTTCCAGGTCGGGG + Intronic
1153535452 18:6097516-6097538 CTCTCCTTCTTTCCACGGCAGGG + Intronic
1154162199 18:11989109-11989131 CTCTCCTCCTGTCCGGGACATGG - Intronic
1155240743 18:23861630-23861652 CTCTCCCTCTTTCCAGTTTGTGG + Exonic
1155930015 18:31697265-31697287 CTCTCTTTTTTTCAGGGTGGGGG - Intergenic
1158078722 18:53563152-53563174 CTCTGCTTTTTTCCGGTTCTGGG - Intergenic
1158600652 18:58853249-58853271 CTCTCTTTCTTTCTGAGACGGGG - Intergenic
1162311823 19:9912639-9912661 CTCTCCTTCTTCCCTGATCCAGG + Intronic
1167539411 19:50075568-50075590 AGCTCCTTCTTTCAGGGTGGGGG + Intergenic
1167630300 19:50622290-50622312 AGCTCCTTCTTTCAGGGTGGGGG - Exonic
925106850 2:1299180-1299202 CACTGCTGCTTTCCGGGCCGTGG + Intronic
925718282 2:6804815-6804837 CTCTCCTTCTTTCTGATTCTAGG + Intergenic
929428769 2:41869812-41869834 CTCCCCTTCTTCCCAGGTTGAGG - Intergenic
940942159 2:159574090-159574112 CTCTCCATCTGTCAGGGTCTGGG - Intronic
944484473 2:200190488-200190510 CTCTCCTCCTTTCAGAGTCCAGG - Intergenic
947800985 2:232928352-232928374 CTCTGCCCCTCTCCGGGTCGGGG - Intronic
1169071984 20:2738405-2738427 CTCTCCTTCTCTTCTGTTCGTGG + Intronic
1170355014 20:15482467-15482489 CTCTCCTTCATTGCTGGTCTTGG + Intronic
1170414238 20:16123123-16123145 CTCTCCTTCTTTCCCTGGGGTGG - Intergenic
1170889301 20:20365136-20365158 CTCCCCTTCCTTCGGGGTCCTGG - Intergenic
1171141644 20:22748835-22748857 CTCTCCTTTTTTGGGGGTTGAGG + Intergenic
1176547763 21:8208934-8208956 CTCGCCCTCTCCCCGGGTCGGGG + Intergenic
1176555659 21:8253139-8253161 CTCGCCCTCTCCCCGGGTCGGGG + Intergenic
1176566708 21:8391973-8391995 CTCGCCCTCTCCCCGGGTCGGGG + Intergenic
1179351885 21:40618911-40618933 CTCCCCTTCTTCCTGGGTCTTGG - Intronic
1179946414 21:44681214-44681236 ATGTCCTGCTTCCCGGGTCGCGG - Intronic
1180197269 21:46205285-46205307 CTCTCCTGCTCTCCTGCTCGCGG - Intronic
1180798122 22:18617637-18617659 ATCGCCTTCTCTCCGGGTCAGGG - Intergenic
1181223596 22:21377629-21377651 ATCGCCTTCTCTCCGGGTCAGGG + Intergenic
1181359288 22:22322648-22322670 CTCTCCTGCTTCCAGGGTCCTGG + Intergenic
1182890181 22:33811639-33811661 CTGGCCTTCTTTCCTGGTCTTGG - Intronic
1184419494 22:44371413-44371435 CTGTCCTTCTTCCCGGCTCTGGG - Intergenic
1184755377 22:46512835-46512857 CTCTTGTTCCTTCCGGGTCCGGG + Intronic
1203252637 22_KI270733v1_random:125219-125241 CTCGCCCTCTCCCCGGGTCGGGG + Intergenic
954774538 3:53004829-53004851 TTCTCATTCTTTCCGGTTCCAGG - Intronic
969272798 4:6114247-6114269 CTCTCCTTCTGTCCTGTTCATGG - Intronic
969815682 4:9685638-9685660 CTCTCCTTTTTTCAGCATCGAGG - Intergenic
1000359283 5:160432696-160432718 CTTTCCTCCTTTCTGGGTGGTGG + Intergenic
1001035450 5:168293003-168293025 CTCTCTTTCTTCCCTGATCGGGG + Intronic
1006806767 6:36793955-36793977 CTCCCCTTCTTTCCCGGTTGGGG - Intronic
1007550860 6:42728500-42728522 CTTTCTTTCTTTCCAGGTTGGGG - Intergenic
1019452617 7:1107743-1107765 CTCTGCTTCCTCCCGGGGCGTGG - Intronic
1019452810 7:1108320-1108342 CTCTGCTTCCTCCCGGGGCGCGG - Intronic
1021601196 7:22365419-22365441 CTCTCCTATTTTCCTGGTCCAGG - Intergenic
1026092244 7:67309874-67309896 CTCACCTTTTTTCTGGGTTGTGG + Intergenic
1026487742 7:70835970-70835992 CTCTCCTTCTTCCCAGGACTTGG + Intergenic
1027768562 7:82377512-82377534 GCCTCCTTCTTTCTGGGTCAAGG + Intronic
1033046418 7:137966493-137966515 CTTTCCTTCTATCTGAGTCGTGG - Intronic
1035203195 7:157279526-157279548 CTCTCCTTCCTTCCTGGGAGCGG - Intergenic
1035210856 7:157327002-157327024 GTCTCCTTCCTTCTGGGTTGGGG + Intergenic
1035718543 8:1772964-1772986 CACTCCTGCCTTCGGGGTCGAGG + Intronic
1036523988 8:9518356-9518378 CTCTCCATCTTCCCGTGTCTGGG - Intergenic
1038295671 8:26289394-26289416 CTCTCCTTCCTTCTGGGTTCTGG + Intergenic
1038992109 8:32879020-32879042 CTCTTCTCCTTTCTGGGTCTAGG + Intergenic
1039013273 8:33118868-33118890 CTTTCCTTCATTCCGGGTGGAGG - Intergenic
1044935915 8:97293223-97293245 CTCTCCTGCTTGCCAGGTTGGGG + Intergenic
1050473294 9:6015626-6015648 CCCTCCCTCCTTCCCGGTCGCGG - Intergenic
1052755024 9:32532163-32532185 CTCCCCTTCTTTCCTGGCCTTGG - Intergenic
1052811870 9:33068356-33068378 CTCTCCCTCTTTCCTGGGAGAGG - Intronic
1054933792 9:70665148-70665170 CTCTTCCTCTTCCCGGGTCTAGG + Intronic
1056206634 9:84325460-84325482 CTCACCTACTTTCAGGGTCAGGG - Intronic
1057282230 9:93721121-93721143 GTCTCCTTCTGTCAGGGTCCAGG + Intergenic
1057337264 9:94166017-94166039 ATCTCCTTCTTTCCTAGTGGAGG - Intergenic
1061130969 9:128707434-128707456 CTCTCCTTCTTTTTGGGGGGAGG + Intronic
1061445269 9:130633970-130633992 CTCTCCTTCTGCCCAGGCCGGGG - Intronic
1061746727 9:132745644-132745666 ATCCCTTTCTTTCCGGGTAGTGG + Intronic
1185724359 X:2407443-2407465 CTCTCCCTCTCTCCGGGTTGCGG - Intronic
1189470344 X:41309012-41309034 CTCTCCCTCTTTCCTGCTGGGGG + Intergenic
1189855756 X:45223583-45223605 CTCTCCTTTTTTCCAGGTGAAGG + Intergenic
1195750458 X:108158530-108158552 CTCTTCTTATTTCCTGGTCAGGG + Intronic